Entry information : EgrGPx01 ( Eucgr.A00055 / Egrandis_v1_0.027047m)
Entry ID 10169
Creation 2012-01-25 (Qiang Li)
Last sequence changes 2016-03-25 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-03-25 (Achraf Jemmat)
Peroxidase information: EgrGPx01 ( Eucgr.A00055 / Egrandis_v1_0.027047m)
Name (synonym) EgrGPx01 ( Eucgr.A00055 / Egrandis_v1_0.027047m)
Class Plant glutathione peroxidase    [Orthogroup: Gpx2001]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrGPx01
start..stop
S start..stop
EglGPx01 404 2e-146 1..196 1..196
EguGPx01 401 2e-145 1..195 1..195
EgrGPx02 396 3e-143 1..196 1..196
EcamGPx01 395 4e-143 1..192 1..192
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 726982..727131 150 N° 2 727850..727926 77 N° 3 728340..728401 62 N° 4 728505..728623 119
N° 5 728971..729138 168 N° 6 729215..729253 39  
join(726982..727131,727850..727926,728340..728401,728505..728623,728971..729138, 729215..729253)


exon

Literature and cross-references EgrGPx01 ( Eucgr.A00055 / Egrandis_v1_0.027047m)
DNA ref. Phytozome 11:   scaffold_1 (726982..729253)
Cluster/Prediction ref. Genebank:   104427344
Protein sequence: EgrGPx01 ( Eucgr.A00055 / Egrandis_v1_0.027047m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   205 (178)
PWM (Da):   %s   23122.7 (19895.1) Transmb domain:   %s   i7-26o
PI (pH):   %s   7.13 (7.13) Peptide Signal:   %s   cut: 27 range:27-204
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQWFKSPSFFPFLFALLALSVYFFNAHRPASRAPEMAEESSKSIYDFAVKDIRGNDVSLSEYSGKVLLIVNVASKCGLTQSNYKELNTLYEKYKDGFEVLAFPCNQFAGQEPGSNEEIQETVCTMFKAEFPIFDVEVNGKNAAPLYKFLKSQKGGIFGDGIKWNFTKFLVNREGKVVERYAPTTSPLKIEKDIQICGDRLEQ*

Retrieve as FASTA  
Remarks Complete sequence from genomic (scaffold_1, 5 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGTGGTTCAAATCCCCCAGCTTCTTCCCATTCCTCTTCGCGCTTCTAGCTCTCTCCGTCTACTTCTTCAACGCGCATCGACCGGCGTCTCGTGCTCCTGAAATGGCCGAGGAATCG
TCCAAGTCCATCTACGATTTCGCCGTCAAG
GTGCCTTTTTCTTTTTTCTTTTGAGATGTCGACTGGGATGATTGGTGGTGCTTATCCTGTTCTGTCTGCTCTTGGGTTGGAGAGGGGAGA
GGTTTTAGAGGCTGCGCTATGTGCAAGATTGGAACTTAGCGTGCGGTCGAAGATGGGTCCTTTTTTTTTCTTTTTTTTTTTTGGGGGGGGGGTGGGGAGCGGAGATTTCAGCTGTCCCCA
TGGGCGTAGGGGCTGATTGGGTTTGAGATGGTGATTGCTTGCGCGTACTCGGTCAGAAACTAACAGCGTCGTTGAAATTCCTAAGCAAGGACAAGCCTTGCTCGGTTTGTTTGTTCTGCG
GCGTGTCGTTAACATGTGATGTGCCCGTTCCATGAAACGCTTGTTTGTAATTCTAATGCTTTTCTTCTGCAACTACGAACTGGCGGGTCGATGACCTGAATGTGGGAGTTAGGTTGAGTA
TCGATCGGATCATGAATCTTTTGCTTTATCACAATTTCTTAGTCAATCCATAATTTGCCTTGAATCCTAATACTGACGATTTTGAATCTTGTTCGGTCTTCTTTCAACTTGATACGGATC
CCTGTTTGTACGTTCGTTTCTGCGGAAGAGGTGGATATGCCATATTGTGCTTCTTACGTTGTAGAAATTTATTTGATGTAGCTTTTCATGGTTTTTATAGTTAGAGATATTTATGACTGT
AGATGTCAATTATCTGATGCATATGCAGGACATTCGTGGAAATGATGTAAGTTTGAGCGAGTACTCTGGGAAGGTTCTTCTGATTGTCAACGTTGCTTCAAAATGGTATCGCCACTGAAT
GCGCCTTCTCTTCAAGAATTGTGTTTCTTTGATTAGAACCTCGATAGGAATTTAGCAACTCAAGCGTTCATGATATGGTTTAGTAGTTGACTAGTTGGTCCTGTTGTATGTCACTATGTG
TTTGACTGCATGCGGAACACTTGCATGTCCAATCTTGAACCTGTTATCACTCTTTTGGTAGTTTAAGCAGCATGAGCCTCCGTCGATCCCGTAAACCTGGGGCTGCTTCTCTTTCCCCTT
TAACGGCTATGCATAGATCTATTAACCATTTGTTCTAGATGTAATTGAGTGGCCAATTGTTAAATCCAGTTCATGTTCCCAGTAACAGTCAACTCCTTGAACTTATATCATCTGCTTTGA
TACTTATGATATCTAATATAGCGCACACATGTTTGCAGTGGTCTCACCCAATCAAATTACAAGGAATTGAACACTTTATATGAAAAATACAAGGATCAAGGTTTGCTCTTTGGTCTTTTG
TGTTTTGATTTCATTCTCATATGTTTTACTCTGCGCTATATCCTTGGGGTTTGTATAGGTTCATGACTGACATTTCTTTGCAGGATTTGAAGTACTGGCATTTCCATGCAACCAGTTTGC
AGGACAAGAGCCAGGGAGTAATGAAGAGATTCAAGAGACTGTATGCACTATGTTCAAGGCTGAATTCCCTATTTTTGACAAG
GTAAACATGAGAAGCCCAAAACAATGAGAAAAATATTA
AATTGAAAGGGAATTCTTGATATTCTGGCTCCTCATGCTTTTTGGTCGTTTTAACTTGAGAGCACTATCAATCTCATAGTACGCATAAAAATTGATGATTGACCAGTTCCAGATGAGGTT
GAGAATTTGCTTGCAATGTGTTTCATTTTCTCTTTCCACAGTGTGATAAAAGAGACTTGTTCTATATGCAAGTTCAAGTTGCATAACCGTCCTCCTCTTTTGCAAATTTGACTCTGTACA
ATATGGAGAAAAGATGTTCTGAGTTGATATTACACTCTATTTTTGATATTGTAGTCTATTGTGCTACAGGTTGAGGTGAATGGCAAGAATGCAGCCCCTCTCTACAAGTTTTTAAAATCT
CAGAAAGGAGGGATATTTGGAGATGGCATCAAATGGAACTTTACAAAGTTTCTGGTGAACAGAGAAGGGAAAGTTGTGGAGAGATATGCTCCCACTACATCACCTCTTAAAATTGAG
GTT
AGGGATCTGATTTACAACAATGCGAAATAGCAATTTAAGTCGAATCTCATTTATTTTTTCGGTTATCCTGCAGAAAGATATCCAAATCTGTGGGGATCGTCTTGAGCAATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGTGGTTCAAATCCCCCAGCTTCTTCCCATTCCTCTTCGCGCTTCTAGCTCTCTCCGTCTACTTCTTCAACGCGCATCGACCGGCGTCTCGTGCTCCTGAAATGGCCGAGGAATCG
TCCAAGTCCATCTACGATTTCGCCGTCAAG
GACATTCGTGGAAATGATGTAAGTTTGAGCGAGTACTCTGGGAAGGTTCTTCTGATTGTCAACGTTGCTTCAAAATGTGGTCTCACCCAA
TCAAATTACAAGGAATTGAACACTTTATATGAAAAATACAAGGATCAAG
GATTTGAAGTACTGGCATTTCCATGCAACCAGTTTGCAGGACAAGAGCCAGGGAGTAATGAAGAGATTCAA
GAGACTGTATGCACTATGTTCAAGGCTGAATTCCCTATTTTTGACAAG
GTTGAGGTGAATGGCAAGAATGCAGCCCCTCTCTACAAGTTTTTAAAATCTCAGAAAGGAGGGATATTTGGA
GATGGCATCAAATGGAACTTTACAAAGTTTCTGGTGAACAGAGAAGGGAAAGTTGTGGAGAGATATGCTCCCACTACATCACCTCTTAAAATTGAG
AAAGATATCCAAATCTGTGGGGAT
CGTCTTGAGCAATAG

Retrieve as FASTA