Entry information : EgrRboh04 ( Eucgr.H04514 / Egrandis_v1_0.002292m)
Entry ID 10176
Creation 2012-01-25 (Qiang Li)
Last sequence changes 2012-01-25 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-19 (Christophe Dunand)
Peroxidase information: EgrRboh04 ( Eucgr.H04514 / Egrandis_v1_0.002292m)
Name (synonym) EgrRboh04 ( Eucgr.H04514 / Egrandis_v1_0.002292m)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrRboh04
start..stop
S start..stop
EglRboh04 1857 0 1..889 1..889
EcamRboh04 1847 0 1..889 1..889
EguRboh04 1781 0 1..889 1..889
PtRboh10 1473 0 1..889 1..886
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 64437076..64437586 511 N° 2 64437808..64437967 160 N° 3 64438081..64438129 49 N° 4 64438240..64438353 114
N° 5 64438521..64438955 435 N° 6 64439097..64439483 387 N° 7 64439584..64439679 96 N° 8 64439813..64439928 116
N° 9 64440038..64440140 103 N° 10 64440325..64440398 74 N° 11 64440541..64441055 515 N° 12 64441194..64441303 110
join(64437076..64437586,64437808..64437967,64438081..64438129,64438240..64438353 ,64438521..64438955,64439097..64439483,64439584..64439679,64439813..64439928,644 40038..64440140,64440325..64440398,64440541..64441055,64441194..64441303)


exon

Literature and cross-references EgrRboh04 ( Eucgr.H04514 / Egrandis_v1_0.002292m)
DNA ref. Phytozome 11:   scaffold_8 (64437076..64441303)
Protein sequence: EgrRboh04 ( Eucgr.H04514 / Egrandis_v1_0.002292m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   889
PWM (Da):   %s   100962.62 Transmb domain:   %s   o340-359i480-502o522-544i704-721o
PI (pH):   %s   9.28
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEIQDHHQHAQWSDTESNCSSRLGYSGPLSSTSTKIRSNARFRDDQDEECYVEITLDVGEDSVSVHNIKGGGDPETALFTSRLGLRPSSLGAQLSFRLRQVSQELRRITSTKGRNNQIDRTRSGAARALRGLQFMTKNVEIDQGWSEVEARFDELALNGVLPKSLFGQCIGMNESSEFASELFDALARRRGITSSAVSKPELREFWEQIADQSFDARLQTFFDMVDKNADGRITEEEVKIIALSASANKLSKIQEQAEEYAALIMEELDPSNLGYIELHNLETLLLQAPIQSRSAHAGSESRVLSQMLSQKLVPTREHNPIKRYYKALAYFIEDNWKRIWVMGLWISICAGLFTWKFIQYKHRAVFDVMGYCVTTAKGGAETTKFNMALILLPVCRNTVTWLRSRTRLGVIVPFNDNINFHKVIAWGIAVGVGLHAGAHLTCDFPRLLHATDAEYEPMKQFFGEKRPNNYWWFVKGTEGWTGVSMLVLMTIAYTLAQPWFRRNRLDLPKALKKLTGFNAFWYSHHLFVIVYVLFVIHGYFLYLAKKWYKRTTWMYLAVPVTLYASERLLRALRSGYKTVRIFKVAVYPGNVMALHMSKPQGFRYTSGQYIFVNCAAVSPFQWHPFSITSAPGDDYLSLHIRTVGDWTSQLKAVFSACQPPSIDQSGLLRADIATGENVPRIPRLLIDGPYGAPAQDYKNYDVLLLVGLGIGATPLISIVKDVLNNIKQQKEMEKGIVESGAKSNKRKPFLTRRAYFYWVTREQGSFEWFRGVMNEVAENDRDGVIELHNYCTSVYEEGDARSALIAMLQSLNHAKNGVDIVSGTRVRTHFARPNWRNVFKHVAVNHPDERGVFYCGVQGVVGEMRRLAQDFSHKTTTKFYFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (scaffold_8, 11 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGATCCAAGATCATCACCAGCATGCTCAGTGGTCTGACACAGAAAGCAATTGTAGCTCCAGACTTGGTTATAGTGGCCCTTTGAGTAGCACGAGCACCAAGATCAGAAGCAATGCA
AGATTCAGGGACGACCAAGATGAGGAATGCTATGTCGAGATCACGCTAGATGTCGGCGAGGATAGCGTCTCGGTTCACAACATCAAGGGAGGAGGAGATCCTGAGACGGCATTGTTCACG
AGTCGCTTGGGGCTGCGGCCCTCATCGCTCGGTGCACAGCTGTCGTTCAGGCTCAGACAAGTCTCACAAGAGCTCAGGCGAATCACCTCGACGAAAGGGCGTAATAATCAGATCGATAGG
ACTAGATCCGGTGCTGCACGGGCATTGCGAGGGCTCCAGTTTATGACCAAGAATGTCGAGATCGATCAAGGTTGGTCTGAGGTCGAAGCAAGGTTCGATGAATTGGCTCTTAATGGAGTT
CTTCCGAAATCACTCTTCGGCCAGTGTATAG
GTATGTCAACTGATTTTGCTAAAAAGAAATGCTAGAATCGAATACTTAATTTATATAAACAAATGTTGATTGTTTCAAACGGAAAGATT
TGCATTTATCACATTGTTCCATCTCAAGAATATTCTGTCAACTCATTTAGTCCTTCGATACATTTCTTAGAAATTAGTGAACTTGCATTAAATTAGAGCAGCGGACTGACAAGGATCGTT
GCATCTGTTTAGGGATGAATGAATCCAGTGAGTTTGCCAGCGAGCTATTTGACGCGCTGGCACGACGGAGAGGCATAACATCGTCTGCGGTAAGCAAGCCTGAGCTACGGGAATTCTGGG
AACAGATAGCAGATCAAAGCTTCGATGCGAGGTTGCAAACCTTCTTCGATAT
GTAAGTTCACTTGCCCATTTCACTATAATAGCTTTCACTTTGAATCAACTAAAAATCAGGTTTACTTG
GGACTTATTCAGACAAATCCACTGAGAAGTTATTTAATGATGCAGGGTAGACAAAAATGCAGATGGTCGGATCACCGAGGAAGAGGTGAAAGAGGTAAGAGATGGTCAAGAAAAGAATAT
GATGATGATGATGATGAGAAATGATTCAATGTGAGAGAATAATTAATAAGTTACTAATTGTGATCATATCATTGTCAACATCAGATAATTGCACTAAGCGCTTCAGCGAATAAGCTGTCA
AAGATCCAAGAACAAGCTGAGGAATATGCAGCCTTGATCATGGAAGAGTTGGATCCTAGTAATCTGGGATACATTGAG
GTACATGTTCAGATCCAAACCTTCGACTTTTTTAAATGATTG
TTGACCATACGACCCACGTACCGTGCTTACTAATATTCAATTACTTATCTAAGATATTGCCTTGATTTAAAAGTCTAAATTGAGTCAAGTACCTGAGAAGAGCATCTGCTGAACTCCTGT
TTTAGCTACACAACCTGGAGACACTCCTCTTGCAAGCCCCGATCCAATCAAGGTCGGCCCACGCCGGGTCCGAGAGCCGGGTCCTGAGCCAGATGCTGAGCCAGAAGCTGGTCCCAACCA
GAGAGCACAACCCCATCAAGAGATACTACAAGGCACTGGCCTACTTCATTGAGGACAATTGGAAGAGGATTTGGGTCATGGGCCTATGGATCTCAATCTGTGCAGGCCTGTTCACTTGGA
AGTTCATCCAGTACAAGCACAGAGCTGTGTTTGATGTGATGGGCTACTGTGTGACCACAGCTAAAGGTGGAGCTGAGACTACCAAGTTCAACATGGCCCTGATTTTGCTTCCAGTTTGCA
GAAACACAGTCACTTGGCTGAGGAGTAGAACCAGGTTGGGTGTGATTGTTCCCTTCAATGACAACATCAATTTCCACAAG
GTATGAACATATTATGCCGCGATAAATTTAGTTGAAAAGT
GTATTTGGATATGCTTTGAAGGAAAAATTGAAAGAGAACATAATTTACTTCATTAAGCACTTAATCTAATTATAAGCGTTAAATGTATGTGGCCTAAATAGGTGATAGCTTGGGGCATTG
CGGTTGGGGTTGGTCTACATGCCGGAGCCCATCTGACCTGCGACTTCCCTAGGCTGCTCCATGCCACCGATGCTGAATACGAGCCAATGAAGCAGTTCTTCGGCGAGAAGCGCCCCAATA
ACTACTGGTGGTTCGTGAAAGGGACTGAGGGCTGGACCGGTGTGTCCATGCTGGTGCTGATGACCATAGCATACACCTTAGCCCAGCCCTGGTTCCGCCGCAACCGGCTGGACCTCCCCA
AGGCCCTCAAAAAGCTCACCGGGTTCAATGCTTTTTGGTACTCGCACCACCTCTTTGTGATCGTCTACGTGCTCTTCGTGATACACGGCTACTTCTTGTATTTAGCCAAGAAGTGGTACA
AGAGAACG
GTGAGTGATAATCTACATCACATTGCTTGGTAATTAATGAGATTTTTACAGTTTGTCCAATATCACATTTCTAACTATGTCTATAAACTCGTTTGCGCAGACCTGGATGTAT
CTTGCAGTACCAGTCACATTATATGCGTCCGAGCGCTTGCTCCGTGCGCTCAGGTCTGGGTACAAGACCGTGCGGATCTTCAAG
GTGAGGCTCGGATTCGATTAAGAGTTGTTCTGTTTT
GAAACACTGCAGAATAGTTGTCCAGACTGATGTTTTAAAACACGAGGCATTCACAATCACAATAACTGAGTTGGGGTCATATTCTGGTGCGTTTCAGGTTGCAGTTTATCCAGGAAATGT
CATGGCTCTGCACATGTCTAAGCCTCAAGGCTTCAGATACACAAGCGGTCAATACATTTTTGTGAACTGTGCAGCTGTTTCTCCATTCCAATG
GTAACTTTTATTTTTTAACAAAAAAGA
CAGGAAAATGATTACTTCTGTACATTACTTGTATTAGCCATTGAAAAGGAACTTGGCTAACTGGTCAATCGAACATTATCAGGCATCCATTTTCGATCACCTCAGCACCCGGCGACGATT
ACTTAAGCCTTCATATACGCACCGTGGGCGACTGGACATCTCAGCTTAAAGCTGTATTCTCGAAG
GTGATTGTTCGAGTTTATTTCTAAGTAACTTTGCGACATACTTGGTCCTGCCTAT
TGGCAACCGATTGCGAGAAATCTTCTGAACTTAAGTAAGGTCCGCATCAGTCTAATTACGACATGCTGTCGTATGGATGTATATGCTCTTTAAAAACATGACGAAAAGTCACATTGTGAA
TGTGTGTAGGCATGTCAGCCTCCATCAATTGATCAAAGTGGACTTCTAAGAGCAGATATCGCAACAGGAGAAAATGTGCCCAGGTAATTAGACTTGTTCGCGCAGCTCATGGTCTGCTCG
GCTCGCTAGGCTTGAAGTCTAGATGAGCAGATTCAGGCAACACGAACATAGCGTATACAGTTTTTCGTAGAATGGGCAAGCTAATTGGATATCATTTTCAACTAGGATTCCGAGGCTCTT
GATCGACGGTCCATACGGTGCTCCAGCACAAGACTACAAGAATTACGACGTGCTTCTCCTAGTCGGGCTTGGCATCGGTGCGACACCATTGATCAGCATCGTCAAGGACGTCCTCAACAA
CATCAAGCAGCAGAAAGAGATGGAAAAGGGCATCGTAGAGAGCGGCGCGAAGAGCAACAAGCGAAAGCCGTTCCTGACCCGGCGGGCCTACTTCTACTGGGTCACCCGTGAGCAGGGCTC
GTTCGAGTGGTTCAGAGGCGTGATGAACGAGGTCGCCGAGAACGACAGGGACGGCGTGATCGAGCTCCACAACTACTGCACCAGCGTGTACGAGGAGGGCGACGCCCGGTCGGCCCTGAT
CGCGATGCTCCAGTCCCTGAACCACGCCAAGAACGGGGTCGACATCGTGTCGGGCACCCGGGTACGGACGCACTTCGCGAGGCCCAACTGGCGCAACGTCTTCAAGCATGTCGCGGTCAA
CCACCCCGACGAAAGAGTTG
GTGAGCATCCTAAAGCACGTCTAGCACATATTTTCCAGGAAGCATAGACATAATTCACTCCAATAAATGATTAATTATCACATTTTCAGCATCTACTCGT
GAGTCGACTAATGTCAAGATGTTTCCTTTCTTCTACAGGAGTGTTTTATTGTGGCGTACAAGGGGTGGTTGGGGAGATGAGGAGGTTGGCTCAGGACTTCTCCCACAAGACCACCACCAA
GTTCTATTTCCACAAAGAGAACTTTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGATCCAAGATCATCACCAGCATGCTCAGTGGTCTGACACAGAAAGCAATTGTAGCTCCAGACTTGGTTATAGTGGCCCTTTGAGTAGCACGAGCACCAAGATCAGAAGCAATGCA
AGATTCAGGGACGACCAAGATGAGGAATGCTATGTCGAGATCACGCTAGATGTCGGCGAGGATAGCGTCTCGGTTCACAACATCAAGGGAGGAGGAGATCCTGAGACGGCATTGTTCACG
AGTCGCTTGGGGCTGCGGCCCTCATCGCTCGGTGCACAGCTGTCGTTCAGGCTCAGACAAGTCTCACAAGAGCTCAGGCGAATCACCTCGACGAAAGGGCGTAATAATCAGATCGATAGG
ACTAGATCCGGTGCTGCACGGGCATTGCGAGGGCTCCAGTTTATGACCAAGAATGTCGAGATCGATCAAGGTTGGTCTGAGGTCGAAGCAAGGTTCGATGAATTGGCTCTTAATGGAGTT
CTTCCGAAATCACTCTTCGGCCAGTGTATAG
GGATGAATGAATCCAGTGAGTTTGCCAGCGAGCTATTTGACGCGCTGGCACGACGGAGAGGCATAACATCGTCTGCGGTAAGCAAGCCT
GAGCTACGGGAATTCTGGGAACAGATAGCAGATCAAAGCTTCGATGCGAGGTTGCAAACCTTCTTCGATAT
GGTAGACAAAAATGCAGATGGTCGGATCACCGAGGAAGAGGTGAAAGAG
ATAATTGCACTAAGCGCTTCAGCGAATAAGCTGTCAAAGATCCAAGAACAAGCTGAGGAATATGCAGCCTTGATCATGGAAGAGTTGGATCCTAGTAATCTGGGATACATTGAGCTACAC
AACCTGGAGACACTCCTCTTGCAAGCCCCGATCCAATCAAGGTCGGCCCACGCCGGGTCCGAGAGCCGGGTCCTGAGCCAGATGCTGAGCCAGAAGCTGGTCCCAACCAGAGAGCACAAC
CCCATCAAGAGATACTACAAGGCACTGGCCTACTTCATTGAGGACAATTGGAAGAGGATTTGGGTCATGGGCCTATGGATCTCAATCTGTGCAGGCCTGTTCACTTGGAAGTTCATCCAG
TACAAGCACAGAGCTGTGTTTGATGTGATGGGCTACTGTGTGACCACAGCTAAAGGTGGAGCTGAGACTACCAAGTTCAACATGGCCCTGATTTTGCTTCCAGTTTGCAGAAACACAGTC
ACTTGGCTGAGGAGTAGAACCAGGTTGGGTGTGATTGTTCCCTTCAATGACAACATCAATTTCCACAAG
GTGATAGCTTGGGGCATTGCGGTTGGGGTTGGTCTACATGCCGGAGCCCAT
CTGACCTGCGACTTCCCTAGGCTGCTCCATGCCACCGATGCTGAATACGAGCCAATGAAGCAGTTCTTCGGCGAGAAGCGCCCCAATAACTACTGGTGGTTCGTGAAAGGGACTGAGGGC
TGGACCGGTGTGTCCATGCTGGTGCTGATGACCATAGCATACACCTTAGCCCAGCCCTGGTTCCGCCGCAACCGGCTGGACCTCCCCAAGGCCCTCAAAAAGCTCACCGGGTTCAATGCT
TTTTGGTACTCGCACCACCTCTTTGTGATCGTCTACGTGCTCTTCGTGATACACGGCTACTTCTTGTATTTAGCCAAGAAGTGGTACAAGAGAACG
ACCTGGATGTATCTTGCAGTACCA
GTCACATTATATGCGTCCGAGCGCTTGCTCCGTGCGCTCAGGTCTGGGTACAAGACCGTGCGGATCTTCAAG
GTTGCAGTTTATCCAGGAAATGTCATGGCTCTGCACATGTCTAAGCCT
CAAGGCTTCAGATACACAAGCGGTCAATACATTTTTGTGAACTGTGCAGCTGTTTCTCCATTCCAATG
GCATCCATTTTCGATCACCTCAGCACCCGGCGACGATTACTTAAGCCTTCAT
ATACGCACCGTGGGCGACTGGACATCTCAGCTTAAAGCTGTATTCTCGAAG
GCATGTCAGCCTCCATCAATTGATCAAAGTGGACTTCTAAGAGCAGATATCGCAACAGGAGAAAATGTG
CCCAG
GATTCCGAGGCTCTTGATCGACGGTCCATACGGTGCTCCAGCACAAGACTACAAGAATTACGACGTGCTTCTCCTAGTCGGGCTTGGCATCGGTGCGACACCATTGATCAGCATC
GTCAAGGACGTCCTCAACAACATCAAGCAGCAGAAAGAGATGGAAAAGGGCATCGTAGAGAGCGGCGCGAAGAGCAACAAGCGAAAGCCGTTCCTGACCCGGCGGGCCTACTTCTACTGG
GTCACCCGTGAGCAGGGCTCGTTCGAGTGGTTCAGAGGCGTGATGAACGAGGTCGCCGAGAACGACAGGGACGGCGTGATCGAGCTCCACAACTACTGCACCAGCGTGTACGAGGAGGGC
GACGCCCGGTCGGCCCTGATCGCGATGCTCCAGTCCCTGAACCACGCCAAGAACGGGGTCGACATCGTGTCGGGCACCCGGGTACGGACGCACTTCGCGAGGCCCAACTGGCGCAACGTC
TTCAAGCATGTCGCGGTCAACCACCCCGACGAAAGAGTTG
GAGTGTTTTATTGTGGCGTACAAGGGGTGGTTGGGGAGATGAGGAGGTTGGCTCAGGACTTCTCCCACAAGACCACCACC
AAGTTCTATTTCCACAAAGAGAACTTTTAG

Retrieve as FASTA