Entry information : EgrRboh02 ( Eucgr.E00785 / Egrandis_v1_0.001715m)
Entry ID 10177
Creation 2012-01-25 (Qiang Li)
Last sequence changes 2012-01-25 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-19 (Christophe Dunand)
Peroxidase information: EgrRboh02 ( Eucgr.E00785 / Egrandis_v1_0.001715m)
Name (synonym) EgrRboh02 ( Eucgr.E00785 / Egrandis_v1_0.001715m)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrRboh02
start..stop
S start..stop
EguRboh02 1984 0 1..965 1..965
EcamRboh02 1876 0 1..965 1..964
CclRboh01 1650 0 1..965 1..946
CsRboh01 1648 0 1..965 1..946
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 8180372..8181080 709 N° 2 8181194..8181353 160 N° 3 8181740..8181788 49 N° 4 8182540..8182653 114
N° 5 8184220..8184642 423 N° 6 8186183..8186569 387 N° 7 8186747..8186842 96 N° 8 8186955..8187070 116
N° 9 8187212..8187379 168 N° 10 8187496..8187655 160 N° 11 8187799..8187996 198 N° 12 8188097..8188225 129
N° 13 8188340..8188418 79 N° 14 8188513..8188622 110  
join(8180372..8181080,8181194..8181353,8181740..8181788,8182540..8182653,8184220 ..8184642,8186183..8186569,8186747..8186842,8186955..8187070,8187212..8187379,81 87496..8187655,8187799..8187996,8188097..8188225,8188340..8188418,8188513..81886 22)


exon

Literature and cross-references EgrRboh02 ( Eucgr.E00785 / Egrandis_v1_0.001715m)
DNA ref. Phytozome 11:   scaffold_5 (8180372..8188622)
Protein sequence: EgrRboh02 ( Eucgr.E00785 / Egrandis_v1_0.001715m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   965
PWM (Da):   %s   108733.03 Transmb domain:   %s   o403-422i542-564o584-606i763-780o
PI (pH):   %s   9.45
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKGLAKHGRRWASDTVPGKSPASDSTSPAGTEASYGEELVEVTLDLQEDDTIVLRSVEPATAASALTIKIDDDDGGGGGCGGGGSGAETPRGASSSAPSRSPAMRRSSSSRLRQFSQELKAEAVAKARQFSQELKAELRRFSWSHGHASRVLSASTSSAGQNAGGFDVALAARALRKQRAQLDRNRSGAQKALRGLRFISNSKTNCSIDAWNEIQASFDKLAKDGCLYRQDFAQCIGMKDSKEFALELFDALGRRRRMKVDRISKDELHEFWCQITDQSFDSRLQIFFDMVDKNEDGRITGEEVKIIMLSASANRLSRLKEQAEEYAALIMEELDPEQLGYIELWQLETLLLQKDTYLNYSQALSYTSQALSQNLQGLRRRSRIRRLSTKCLYYLEENWRRIWVVTLWVMIMIGLFTWKFVQYKQKAAFQVMGYCLLTAKGAAETLKFNMALILLPVCRNTITWLRNTRVGLFIPFDDNINFHKTIAAAIVVGVILHVGDHLACDFVRLEHASKDVYHRYLEDDFGNPKPTYFDLVKGIEGVTGILMVILMLIAFTLATRWFRRSLVKLPKPFDRLTGFNAFWYSHHLFVLVYILLIIHGVFLYLVHHWYRKTTWMYLAVPVLLYAGERTLRFFRSGMYTVRLLKVAIYPGNVLTLKMSKPPQFKYKSGQYMFVQCPAVSPFEWHPFSITSAPGDDFLSVHIRQLGDWTQELKRVFAEACEPPVAGKSGLLRADETTKKSLPKLCIDGPYGAPAQDYKKYDVLLLVGLGIGATPFISILKDLINTIVKSEEQDSVTDVSRNSDLSIGSVESPGPNRVSPRRRKTLKTTNAYFYWVTREQGSFDWFKGVMNEVAEIDQRGVIEMHNYLTSVYEEGDARSALITMVQALNHAKNGIDIVSGTTVRTHFARPNWKKAFNKLCSKHSGARIGVFYCGAPVLAKELSKLCYEFNQKGPTKFDFHKEHF

Retrieve as FASTA  
Remarks Complete sequence from genomic (scaffold_5, 13 introns). Correct prediction from phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGGCCTCGCCAAGCACGGGCGCCGGTGGGCGTCGGACACCGTCCCCGGCAAGTCACCGGCCAGCGACAGCACTTCGCCGGCGGGTACGGAGGCCAGCTACGGCGAGGAGCTCGTG
GAGGTGACCCTCGACCTGCAGGAGGACGACACGATCGTCCTCCGCAGCGTCGAGCCCGCCACGGCAGCCTCCGCGTTGACTATCAAGATCGACGACGACGACGGCGGCGGCGGCGGCTGC
GGCGGCGGCGGCAGCGGGGCCGAGACGCCCCGCGGGGCTTCCTCCTCGGCCCCGTCCCGGTCGCCGGCGATGCGCCGCAGCTCGTCGAGCCGGCTCCGGCAGTTCTCGCAGGAGCTGAAG
GCGGAGGCGGTGGCCAAGGCGCGGCAGTTCTCGCAGGAGCTCAAGGCGGAGCTGCGGCGGTTCTCGTGGAGCCACGGCCACGCGTCCCGCGTGCTCTCAGCGTCCACGTCGTCCGCCGGC
CAGAATGCCGGCGGCTTCGACGTGGCCCTGGCGGCCCGGGCCCTGCGGAAGCAGCGCGCGCAGCTCGACCGGAACCGCTCGGGCGCCCAAAAGGCCTTGCGCGGGCTGCGGTTCATCAGC
AACAGCAAGACCAACTGCAGCATCGATGCATGGAACGAAATTCAGGCTAGCTTCGATAAGCTTGCCAAAGATGGTTGTCTCTATCGTCAAGATTTCGCACAATGCATAG
GTTTTCGCCAT
CTCTCTCTCTCTCTCTCTCTCTCTAAATTCACGTCCCTTTATGGTGGATTTCTCTCCTTAGCGTTCATACTGACGACGTCCTTGTCTTTTTTCCCGGTGAAGGAATGAAAGATTCGAAGG
AGTTTGCTTTGGAACTGTTCGATGCATTGGGGAGGAGGAGGAGAATGAAGGTCGACAGGATCAGCAAAGACGAGCTCCACGAGTTCTGGTGTCAGATCACTGATCAGAGCTTCGATTCAC
GTCTCCAGATCTTCTTCGACAT
GTACGCATGATGATCGCGATGATGATGATGAATTAAAAAAAAAGAAAAAGAACCAACTTGATAACTTTTTTCTTTTCTTCTTTTTTTTTTTACACTGT
TGTGTTTTGATAAAGATTGCACTTCTTTAACAAACTAAGGAACAGACCGATTCATCTCCATTAGGTATTTTTAATTATTTTCATATTAACGCGAGATGATTGTGTATTGTCAGTGGGTAA
AGAGCCAGAAGCGAGAAAAGCAAGAACAGGGACCGCTGAACAATATCTTAATTATGGACCTAATTATTGATCGAGTCATATGTTTTTTATTTGCACCTAGTACGTTTTTCATTAAAAACA
ATCTGTTTGGTCGATAATTAATCTTTTCTCTTGTTGAATACATGACAGGGTAGACAAGAACGAGGACGGAAGAATCACCGGAGAAGAAGTAAAAGAGGTGAGAGTTCTGTTTGAACCGAT
TGTCATTAGCTGTCATTTTCGAGAAAATTAAAGCTCGATAAGACCCGGCGACCCTGTTAAACTAAACTCCTAGACTGATTATATATATGCGCAATAGATTGGACCGTACATAATTAATTG
GAATAGGAACTAATGTGCATGAATTAGCCAACACTCCTTCATGTCCTCGTGTAAGCCATCGCAATAAACTAGGTTTTCCTTACAGGGTGTCATGTTTCGGTTACAATATAATAATCGATG
TTAGGCGAGGTTCGGTGAGCCCCAAAAATCCCTGAAATTCCACAACGAAACTACTCCATCACAACGATAACAAAAAAAAGAAAGCGAAGTTTTATAAAATAATGTTTCGGTTTTTTCTTT
TTTCCTTCCTGGGCTTGCTCTGACGTTGCCCATGTTCTAAAAGCATCTTCTTATTCATTAAAGATTTTTTGGGGGTATTCGTGGGTTTCCATGAGCTCTTAGGCCCCCTATTCCGTGATG
TCTAGGGGGACAAATGGCAAGTTTTCTCCACTACAATCGTATTCCCGAACGCAATAATTACTATTTTCAGTGGGGTTGGTGGGGGCTTTTCGGTCAACTCGGGGCCGGTCCGACGTGTCA
CGGTTGTCTTCTTGATGCATGCAACCTTGGGTTACGTGGACTTGCGAGTCATTAATGCCCGGTTGACGTAAAGAACCCTAATTTCCACAGTTCCTGTTCTTGATTTTGATTGCTGCCGAT
GGTTGCAGATCATAATGCTGAGCGCCTCGGCGAATCGATTATCGAGGTTGAAGGAGCAGGCGGAGGAGTACGCAGCTCTGATCATGGAAGAACTGGATCCGGAGCAGCTCGGCTACATCG
AG
GTCGGTCCATTTTTTTATTTTATTTTTATGATTTCGCCCTAAAATCTAAAGATAATGCAAAGTCCAAAATACATATATTTCGTCAGACTATAGTTTTCCCAATAGTTAGTGGGGATAC
GCATCTTAATCGAGTCAGCTTTGACCAGTAGTTTTTTTATAAGAGTAATACTCGAGGGGGTCTAAGTATTAGTTACGACTTTTCCTCCTAAAGTCCATGTTTGGCGAAAAATGGAAATTT
TTTTCTAAGAATTGGGTAACCGTGTTGTTGAACCGCGCAAGAAGAAAATAGTAAAAGCTTATGACTATATATAAATATATGTGTGTATATATTCATATTAATATTTGTAGACGTAGCTAG
CGCATTACTTTTGGATTGACCAAATTAGATTGTTTAGAAGGCAAAAGCAGCTGACGAAATTTCTAAAATTTTTGGTAGTTGAGCGACTTTTCTTCGACCTTCAAGCCCATTTCTTCTAAA
AGTTTCGGTAATTAGGGTTTCTCCTTTCCGTGGTAACTTTGTTATTTCTAGGTCAGTGCAATAATTGGTACGACCGATAAGCCACGCATATCATGTCATCTTCCTTACTTTGTTGTCCTT
AATCAAGCAATAAATCTAGGGTCCGATTGAATGGACTTAAATCAAAATGGCAAAAAATAAAATAAAATTTGTGGCCGATACATTAACACAAGCTGTTTTATCATGTAGTTACAGCCAAAA
AGAAGGGTAGCCTTAACATAATAAATTCTCAAATAATTATATTCGTAATCGTTTTATTTATTCCTTAAGTATATAGCAAGAATAGGTGAGTTCCGGTCTTTCTGGGTCCGAGAGCATGTC
CATCGCGCCTGCGTTTGACACCTTTCCTGGCTGTACTCACACGACGAATCTTCTGCACTAAATTCTCATTTTTCTTTTCTTTTCTCGGCTGCTAAAGATTTTCCGGGGAAATTTCAGTCC
TCCCAATGGCGGAGAAAAACCGACGTAGATATGCATCGCGATTGGTGGCATGTAGCTTGTCGGAACGAGTAGGTGGGGGGGGCTCTTCGGGGTGCCCCACGCACGACCGCGTAGACCACA
CCCGGTGCACGAAATTTCCCCGCGTGCTGTCCTGTTTCGGTGGTCACCGTCGCTGGGGGGTCTGTCGAGCTTTTTCTCGACCCGATCCCTCTTTTGTCTTTTCCGCCTCGTCCCATCCCA
CGATTCCGATCCTAAAGAGACGCTCGTTGAATTCGAGAGTTTCCGTGATGGCGAACATGGGGAACGATGGGAAGCGCCAGACTTCGAGACTAACAACATCTCGTTTTCCTTTAACTAAAA
CTGATGTCATCGTATGCGTGGAACGTTTCTTGCTTTTGGTCACATGCGACGGTGACGCATCGATTCCATGGATCGAGGGGCGGTGCCCATGTCATGCACAAAGCTTTCTACTCATGGCAG
AAAAAAAGAGGAGGAAAAATCCCACTTAAAATGTAAATGACATGGGAGAAAAGTAAAATTTTACCGGCTTTAGCTTGCAATTTAGCCTGCAATTTAGCCCCTGAATTCTTGGTGAAAATC
GGATGCAGCTATGGCAACTGGAGACGCTGCTGCTACAGAAGGATACGTACCTAAACTACAGCCAGGCGCTGAGCTACACGAGCCAAGCGCTGAGCCAAAACCTGCAGGGCCTGAGGAGGA
GGAGCCGCATCAGGAGACTGAGCACCAAGTGCCTGTACTATCTGGAAGAGAACTGGAGGAGGATTTGGGTGGTGACCTTGTGGGTCATGATCATGATCGGCCTCTTCACCTGGAAGTTCG
TGCAGTACAAGCAGAAGGCCGCCTTCCAGGTCATGGGCTATTGCCTCCTCACGGCGAAGGGGGCCGCCGAGACGCTCAAGTTCAACATGGCCCTCATCCTGCTGCCGGTGTGCCGGAACA
CCATCACTTGGCTCCGCAACACGAGGGTCGGCCTCTTCATACCCTTCGACGACAACATCAACTTTCACAAG
GTGCGCAAATTTTACCTCTTTCCTAACTTTTGATTTACTATATAGGCTA
TCTCAAATTCATGCCTAATGCTTTTCGTGAAATGCTGTATTATTACCAGAATTGATACTGTGAACTTAGCTACATCCTCAATAGTGAACATTCCATATGTTGTGGATCCAATCATGAACC
GACAGCTCGAGCAACCCATGCCCAGTGCCCCTAATGCATGCTCCATGACTGATGTGCATATTTTTAAGCTTATAAAAATTTTGGAATAAATTAGGTCCGACGGATGGAAATTAAACATGT
CTAATCCATCCGTATGATTAAAAATTTCATCTTAATCACGGAACCTAACCCTCCTTTTTGAAATTTCCAATCCTTCGATTATTTTCCACATCATTTAGCTAGTTTTGTCCTCCTATAGGC
GGTGGAAACTTTGGTTGCACACAATTTTTTTCCCTTGGGGACCCACGAGGAGGATTTCTGGTGAAAGTCAACGTGATTGATTTGATCTGGACACTCGTTTTTTAAAGGGAAAAAAAACTG
ATTCCTGATATGTCTCTTTGGGTGCACATAGATGACGACGATATGTCCTGTGTTAGAACGCGTATGGTGCAGTGCAAGGCATCATCTTTCTGCTTAAAGGCAGCAAAGGTTGACAAATGA
GAATCTTCCCTTGGGCCAGAGAGATCACGATTGTTTTTGTTTGTATGCAGAGAATTAGAAGAACTTGTGGAAAGCCATAAAGATTGACTCTTTCTTTTTCCTCCCCTTAACGAGTTGAAA
ATTGAGAAAAAAACACGTGGAAAAGGAAACTCTGTTCAGCCTAAAATGATTCCTTGTGATGATTGCGTGTTAGTTTATAGACTATGAAGCTTTTGTTTATATGTATGAGCTAGTTAAGCT
AGGAGATTGACTTCTTAGCGACATAAAGAAAGTATCTCTTGCATTTCCCAAGATCCTTAAGAAGAAACTCTGTTTTGTGGCATTGTAAATTGGCAGGAGAGCAAGAATGCATCGATCATT
GCTTGAATAAATTTCGATACAGAAAATCACAACTTAAAGCGTGACAAGATACAGATGTGATGCATAGAACAAATGTCGATTGTGATTTTCAGGTTCTGAACATGGAGAGGAAGAGAGATT
GGCTAATCAAATGATAGATTTTATTTTGCAATGTCATTCTAAGTGATAATGTCTGATATGATGCAAAATGCTGCTCAGATATGTAGAACTACGCATGTGATGGGGAATGACATTCCTAGG
ATCTTTTAGGTTGTCTGATTAGTGAAAAAGCAAGAATTCTGAGAAGAGAATGTTTTTTTTTTGAGGTCAGTGATCTTAGCGACGGAAGCAATGTCTCCACCATTTGCATAATTACCGGAG
TCATGCTTTTTACTGATACTTTGGATTAACGAGAAACTGAAACGTTGTCCCCTTAGCCTAGCAGCTAGTGAATCATCAGTTATTAGTGATGGGATGATACTTGAGTTTCAGGATTCATAG
CAAGAATTGCAACATCTGAATAATATCTTTCTGGTTTGTACATTGGTGCAGACGATTGCTGCTGCTATTGTAGTTGGTGTCATCCTCCATGTGGGTGACCATCTTGCGTGCGATTTTGTG
AGGCTTGAACATGCGTCTAAAGACGTCTATCATAGATACTTGGAGGATGATTTTGGTAATCCGAAGCCGACGTACTTTGATCTTGTCAAGGGGATTGAAGGTGTGACTGGGATCCTCATG
GTGATCTTGATGTTAATAGCCTTCACATTGGCTACCCGATGGTTCCGCCGAAGCCTCGTCAAGTTACCGAAACCATTCGACCGGCTCACTGGTTTCAATGCATTTTGGTACTCACACCAC
CTGTTCGTGCTCGTCTATATCCTGCTCATCATTCACGGAGTCTTCCTTTACCTCGTTCACCACTGGTACCGCAAGACG
GTACGAATCGTTTTCTTTCCCTGCATTCCATGAACTTTCTGA
GAATTAGGCATCTTCAATGTGCTGCGTTCTTTTTCCAACATTGAAATATTGAAAGACAGCTGGTGTATTCCTAACGTAGTCGCATCTAAGTCCGCAGGACTTGAGTTTTGAAATGTGGAG
TTTGTGTCCTTGCAGACGTGGATGTATCTTGCTGTTCCTGTATTGCTCTATGCCGGAGAAAGGACCCTGAGATTCTTCAGGTCTGGAATGTACACGGTCCGACTGCTGAAGGTAACAAAA
GCATTCCCGCGTCATCCATCTTCCCAATTTGATACTCATCTTCATTCGTTGGGCCTTCAATTAAAATTGTTGACATTTAGAGCGAATCGTCTTGATTGTTTAGGTTGCGATCTACCCAGG
AAATGTCTTGACGTTAAAGATGTCGAAGCCTCCCCAATTTAAGTACAAAAGCGGGCAGTACATGTTTGTCCAGTGTCCTGCGGTTTCTCCATTCGAGTG
GTAAGTCCCCAAGTAATGACG
ATAAGTGTCACTGAGGACAATGCATTTTGCTTATGGTAATGGCCTTCTTGAGCGGACTGCTCAACTGCATATGGTCTCCTCGCATACATACTGATCTCTTCTCCCGACACACATTGCCAG

GCACCCATTTTCGATAACCTCAGCTCCCGGTGACGACTTCCTCAGTGTTCACATCCGTCAACTTGGCGACTGGACGCAAGAGCTCAAAAGGGTGTTCGCCGAGGCTTGTGAGCCTCCTGT
TGCAGGAAAGAGTGGCCTCCTCAGGGCTGATGAAACAACCAAGAAAAG
GTGCGCACACTTCCTGTTCCATTCTTTCGTTGTCCACAAGCTATAATTTTCCGATAACTGAACATGAGCTTC
TGGAATTAATGATAATCAAGACCACATTCCTTTGTTGATTACAGTTTGCCGAAGCTCTGCATAGACGGCCCATATGGCGCTCCAGCACAAGACTACAAAAAATACGATGTGTTGCTGCTG
GTTGGTCTCGGAATTGGGGCAACGCCTTTCATTAGTATCCTCAAAGATTTAATCAACACCATTGTCAAAAGCGAGGAGCAAGCA
GTAAGTACTACATACTCTTTAACTTTTTAATTACCT
TTCGAACAACATGATCGTGGACTGATGATGCAAATGAGAATGAATTGGCATTGTACCTGTGAGAATTCAAGACCAATTTTCCTTTTGCCTCCTTTCTTTGTTTGCAGGACTCAGTCACAG
ATGTCAGTAGGAACTCGGATTTAAGCATCGGGAGCGTTGAGTCACCTGGCCCGAACCGGGTCTCCCCAAGGCGCAGGAAGACTCTGAAAACCACCAATGCGTACTTCTACTGGGTGACGA
GAGAACAAGGGTCGTTCGATTGGTTCAAGGGGGTCATGAATGAGGTCGCGGAGATTGACCAAAGG
GTAAGAAAGAGTGCTTTCTCTTGAGCCCAATTTTCAGCTCATTAATCGAATTGAT
TGAAGTTTTGTCTTTACTGATCACGTTCTGGTGTGGGACTTCTAGGGGGTGATTGAGATGCACAATTATTTGACCAGTGTGTACGAGGAAGGTGATGCAAGATCAGCTCTCATCACTATG
GTCCAAGCTCTTAATCATGCCAAGAATGGGATAGACATTGTGTCTGGGACAACG
GTAAGTATCCTTCTTCCTCTTCTTCTTTTGTCAATTTAATATTTGTTGTTTTCTTTTCCAATCCAC
AACCGTACGTCACATCCTGAATCGCAAAATGGAAACGTTTGCATTCAGGTAAGGACTCATTTTGCAAGACCCAACTGGAAAAAGGCTTTCAATAAACTATGCTCCAAGCACAGCGGTGCA
AGAATAG
GTAATTCTCAACCCAGTTGAATCACAGAAGCTACTTAATCAATCTTCAAATATTCAATTTTTATTCCTTCTTTTTTTGGGTTTCCTTGAATCAGGTGTTTTCTACTGTGGAGC
GCCTGTTCTGGCCAAGGAGCTGAGCAAGCTCTGCTACGAATTCAACCAGAAAGGCCCCACCAAATTCGACTTCCACAAGGAGCATTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGGCCTCGCCAAGCACGGGCGCCGGTGGGCGTCGGACACCGTCCCCGGCAAGTCACCGGCCAGCGACAGCACTTCGCCGGCGGGTACGGAGGCCAGCTACGGCGAGGAGCTCGTG
GAGGTGACCCTCGACCTGCAGGAGGACGACACGATCGTCCTCCGCAGCGTCGAGCCCGCCACGGCAGCCTCCGCGTTGACTATCAAGATCGACGACGACGACGGCGGCGGCGGCGGCTGC
GGCGGCGGCGGCAGCGGGGCCGAGACGCCCCGCGGGGCTTCCTCCTCGGCCCCGTCCCGGTCGCCGGCGATGCGCCGCAGCTCGTCGAGCCGGCTCCGGCAGTTCTCGCAGGAGCTGAAG
GCGGAGGCGGTGGCCAAGGCGCGGCAGTTCTCGCAGGAGCTCAAGGCGGAGCTGCGGCGGTTCTCGTGGAGCCACGGCCACGCGTCCCGCGTGCTCTCAGCGTCCACGTCGTCCGCCGGC
CAGAATGCCGGCGGCTTCGACGTGGCCCTGGCGGCCCGGGCCCTGCGGAAGCAGCGCGCGCAGCTCGACCGGAACCGCTCGGGCGCCCAAAAGGCCTTGCGCGGGCTGCGGTTCATCAGC
AACAGCAAGACCAACTGCAGCATCGATGCATGGAACGAAATTCAGGCTAGCTTCGATAAGCTTGCCAAAGATGGTTGTCTCTATCGTCAAGATTTCGCACAATGCATAG
GAATGAAAGAT
TCGAAGGAGTTTGCTTTGGAACTGTTCGATGCATTGGGGAGGAGGAGGAGAATGAAGGTCGACAGGATCAGCAAAGACGAGCTCCACGAGTTCTGGTGTCAGATCACTGATCAGAGCTTC
GATTCACGTCTCCAGATCTTCTTCGACAT
GGTAGACAAGAACGAGGACGGAAGAATCACCGGAGAAGAAGTAAAAGAGATCATAATGCTGAGCGCCTCGGCGAATCGATTATCGAGGTTG
AAGGAGCAGGCGGAGGAGTACGCAGCTCTGATCATGGAAGAACTGGATCCGGAGCAGCTCGGCTACATCGAG
CTATGGCAACTGGAGACGCTGCTGCTACAGAAGGATACGTACCTAAAC
TACAGCCAGGCGCTGAGCTACACGAGCCAAGCGCTGAGCCAAAACCTGCAGGGCCTGAGGAGGAGGAGCCGCATCAGGAGACTGAGCACCAAGTGCCTGTACTATCTGGAAGAGAACTGG
AGGAGGATTTGGGTGGTGACCTTGTGGGTCATGATCATGATCGGCCTCTTCACCTGGAAGTTCGTGCAGTACAAGCAGAAGGCCGCCTTCCAGGTCATGGGCTATTGCCTCCTCACGGCG
AAGGGGGCCGCCGAGACGCTCAAGTTCAACATGGCCCTCATCCTGCTGCCGGTGTGCCGGAACACCATCACTTGGCTCCGCAACACGAGGGTCGGCCTCTTCATACCCTTCGACGACAAC
ATCAACTTTCACAAG
ACGATTGCTGCTGCTATTGTAGTTGGTGTCATCCTCCATGTGGGTGACCATCTTGCGTGCGATTTTGTGAGGCTTGAACATGCGTCTAAAGACGTCTATCATAGA
TACTTGGAGGATGATTTTGGTAATCCGAAGCCGACGTACTTTGATCTTGTCAAGGGGATTGAAGGTGTGACTGGGATCCTCATGGTGATCTTGATGTTAATAGCCTTCACATTGGCTACC
CGATGGTTCCGCCGAAGCCTCGTCAAGTTACCGAAACCATTCGACCGGCTCACTGGTTTCAATGCATTTTGGTACTCACACCACCTGTTCGTGCTCGTCTATATCCTGCTCATCATTCAC
GGAGTCTTCCTTTACCTCGTTCACCACTGGTACCGCAAGACG
ACGTGGATGTATCTTGCTGTTCCTGTATTGCTCTATGCCGGAGAAAGGACCCTGAGATTCTTCAGGTCTGGAATGTAC
ACGGTCCGACTGCTGAAG
GTTGCGATCTACCCAGGAAATGTCTTGACGTTAAAGATGTCGAAGCCTCCCCAATTTAAGTACAAAAGCGGGCAGTACATGTTTGTCCAGTGTCCTGCGGTT
TCTCCATTCGAGTG
GCACCCATTTTCGATAACCTCAGCTCCCGGTGACGACTTCCTCAGTGTTCACATCCGTCAACTTGGCGACTGGACGCAAGAGCTCAAAAGGGTGTTCGCCGAGGCT
TGTGAGCCTCCTGTTGCAGGAAAGAGTGGCCTCCTCAGGGCTGATGAAACAACCAAGAAAAG
TTTGCCGAAGCTCTGCATAGACGGCCCATATGGCGCTCCAGCACAAGACTACAAAAAA
TACGATGTGTTGCTGCTGGTTGGTCTCGGAATTGGGGCAACGCCTTTCATTAGTATCCTCAAAGATTTAATCAACACCATTGTCAAAAGCGAGGAGCAAGCA
GACTCAGTCACAGATGTC
AGTAGGAACTCGGATTTAAGCATCGGGAGCGTTGAGTCACCTGGCCCGAACCGGGTCTCCCCAAGGCGCAGGAAGACTCTGAAAACCACCAATGCGTACTTCTACTGGGTGACGAGAGAA
CAAGGGTCGTTCGATTGGTTCAAGGGGGTCATGAATGAGGTCGCGGAGATTGACCAAAGG
GGGGTGATTGAGATGCACAATTATTTGACCAGTGTGTACGAGGAAGGTGATGCAAGATCA
GCTCTCATCACTATGGTCCAAGCTCTTAATCATGCCAAGAATGGGATAGACATTGTGTCTGGGACAACG
GTAAGGACTCATTTTGCAAGACCCAACTGGAAAAAGGCTTTCAATAAACTA
TGCTCCAAGCACAGCGGTGCAAGAATAG
GTGTTTTCTACTGTGGAGCGCCTGTTCTGGCCAAGGAGCTGAGCAAGCTCTGCTACGAATTCAACCAGAAAGGCCCCACCAAATTCGACTTC
CACAAGGAGCATTTCTAA

Retrieve as FASTA