Entry information : EgrRboh01 ( Eucgr.C00773 / Egrandis_v1_0.002005m)
Entry ID 10178
Creation 2012-01-25 (Qiang Li)
Last sequence changes 2012-01-25 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-16 (Christophe Dunand)
Peroxidase information: EgrRboh01 ( Eucgr.C00773 / Egrandis_v1_0.002005m)
Name (synonym) EgrRboh01 ( Eucgr.C00773 / Egrandis_v1_0.002005m)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrRboh01
start..stop
S start..stop
EguRboh01 1892 0 1..925 1..925
EcamRboh01 1640 0 137..925 1..789
EglRboh01 1624 0 100..925 31..856
VvRboh07 1470 0 3..925 10..917
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 12891463..12892066 604 N° 2 12892197..12892353 157 N° 3 12893091..12893139 49 N° 4 12893356..12893469 114
N° 5 12893598..12894020 423 N° 6 12894409..12894792 384 N° 7 12894893..12894988 96 N° 8 12895177..12895292 116
N° 9 12895377..12895547 171 N° 10 12895635..12895791 157 N° 11 12895875..12896063 189 N° 12 12896171..12896299 129
N° 13 12896491..12896569 79 N° 14 12897053..12897162 110  
join(12891463..12892066,12892197..12892353,12893091..12893139,12893356..12893469 ,12893598..12894020,12894409..12894792,12894893..12894988,12895177..12895292,128 95377..12895547,12895635..12895791,12895875..12896063,12896171..12896299,1289649 1..12896569,12897053..12897162)


exon

Literature and cross-references EgrRboh01 ( Eucgr.C00773 / Egrandis_v1_0.002005m)
DNA ref. Phytozome 11:   scaffold_3 (12891463..12897162)
Protein sequence: EgrRboh01 ( Eucgr.C00773 / Egrandis_v1_0.002005m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   925
PWM (Da):   %s   104532.21 Transmb domain:   %s   o364-386i445-464o500-522i545-567o577-591i727-744o
PI (pH):   %s   8.5
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGSKRSSYSRGFDLPEEFDDEEDEAAAAADYGSVGGAMLPVFLNDLRQNSQQDLVEVTLELEDDSIVVRSVTPTSNNNLAFSAAADENPDPAAAAAALDRNLSVTTRIRRKFPWLRSGSSRAGSEAEAPTAAAAAREARRARAQLDRSRSSAQRALKGLRFISKANFCARDAEELWRQVEARFHRLARDGLLAREDFGECIGMDSKEFAVGMFDALARRRRQRIGKITREELHDFWLQISDQSFDARLQIFFDMADSNEDGRITRAEVQLLMLSASANKLSKLKERAEEYASLIMEELDPENLGYIELWQLETLLLQKDTYMNYSRTLSTTSLGWSQNLSSFRPTDKVRRICSSLRCLVLENWQRGWILLLWAIVMGCLFAWKFIQYRNMAAFHVMGYCLATAKGAAETLKLNMALILLPVCRNTLTWLRSTRARSFIPFDDNINFHKIIACAIVIGIILHAGDHLACDFPRLVNSSPEKFALISSDFNNRKPTYTDLLSGVEGVTGIAMVVLMAISFTLATHRFRRNIVRLPAPFNRLTGFNAFWYSHHLLGVVYVLLLIHGTFLYLVHEWYMKTTWMYISIPLLLYILERSMRACRSNHYAVRILKVSVLPGNVFSIIMSKPQGFKYRSGQYIFLQCPTISPFEWHPFSITSAPGDDYLSVHIRTVGDWTQELKKTLTEGRDSSCVIGRAKFTSVGCINQTGQPKLLVDGPYGAPAQDYRNYDVLLLVGLGIGATPFVSILRDLLSNTRAEEQDSITETSRSDDSTNSFASSNVTPGSKRKSQRTSSAHFYWVTRESGSFEWFKGVMNEVAEMDHKGQIELHNHLTSVYEEGDARSTLITMVQALNHAKHGFDILSGTRVRTHFGRPNWREVFIKVASKHPYTTVGVFYCGMPMLAKELRKLSHELSHKTSTRFEFHKELF

Retrieve as FASTA  
Remarks Complete sequence from genomic (scaffold_3, 13 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGTCGAAGCGGTCCAGCTACAGCCGCGGGTTCGACTTGCCCGAGGAGTTTGACGACGAGGAGGACGAGGCGGCCGCTGCCGCCGACTACGGCAGCGTCGGCGGGGCAATGCTGCCC
GTGTTCCTCAACGACCTGCGGCAGAACTCGCAGCAGGACCTCGTGGAGGTCACCCTCGAGCTCGAGGACGACTCCATCGTCGTCCGCAGCGTCACTCCGACGAGCAACAACAACCTGGCG
TTCTCCGCGGCCGCCGACGAAAACCCCGATCCCGCGGCGGCGGCGGCGGCGCTGGACAGGAACCTGTCGGTCACGACGAGGATCCGGAGGAAGTTCCCGTGGCTGCGGTCCGGGTCGTCG
CGGGCCGGCTCGGAGGCGGAGGCCCCGACGGCGGCGGCGGCCGCGAGGGAGGCGCGGAGGGCGAGGGCGCAGCTGGACCGGAGCCGGTCGAGCGCGCAGAGGGCGCTGAAGGGTCTCCGG
TTCATCAGCAAGGCCAACTTCTGCGCCAGGGACGCCGAGGAGCTCTGGCGCCAGGTCGAGGCCCGCTTCCACCGCCTCGCCAGGGACGGCCTGCTCGCCCGCGAGGACTTCGGCGAATGC
ATCG
GTACGTTCTCCAAATCCCATCGCCATCGTTACAGTAGTGCATGCGAGACGTGGTGAAATGTGTGCGGACGGGTTGCGAAGGAAGTTGACGGTTGGCGGCGGTGGGTTTTGCTTTGC
TGTTGGAAAACCAGGGATGGACTCGAAGGAGTTCGCGGTGGGGATGTTCGACGCGCTGGCGCGGCGGCGGCGGCAGAGGATCGGGAAGATCACCAGGGAGGAGCTGCACGACTTCTGGCT
CCAAATCTCCGACCAGAGCTTCGACGCGCGGCTTCAAATATTCTTCGACAT
GTGGGCCCCCCTCTCCCTGTCTCTCTTTATCTCTCGATTCGTCTAGCCGTTTCGTGACCGTTCGATCGG
ATCGGAGCGATGGCTTCCTGGCCTCGTTGACCGTGCCTTTTCGATCGATCTGACGGCGGGGGATGCGGAATCCGAGGCAGGCCCGGCCGCCCCCTGGCCGCATGATCTCGCCCGAGGTTT
CCGGCGGTCATCTCTCGGGATGATCGCCGGCGTATTAATTGCCTGACAGAAAGAAAAGACGAGAAGTGTCGTTGAAGCTTTAATTTACTTGTCGGACTCCATTGATTATTATTACCCGCG
AAAAGTGAAGTACATTGAATGTTACTTTTTGAAGAGCAAAAAGGATTTTGTCCAAATGGATTTTTGGTAGTGAATTTCGTGATTTTGAATGTACCCTTTCTTTGTCTTTTTACGTGTAAT
CAACTCGTTGAAAATTAGAATTTATACACTAAGAATAGCAGTTGTTATTAAGATCATGCTAGAGTTATTATTGTCTTGGTCGGGGCCCAAGTCGTCGATAATTGTTGGGAATTTCTGCTT
TCTTGGGTCATGAAAAAATTTAATGCTTTCATTAAAAATGGAGAGGAAAATCTTAGTTATTTTTTTGCGTATTTGAACTAGATTTAGTGTACCTCCTCAATTTACTTGGTAATTCATGTG
ACTTGACAAATGCCCTAAAAGCCCTGATGAAAAGTCCTGACGTGTGTGTATCCTTTGTGCTTTATTAGGGCGGACAGCAATGAAGATGGGAGAATCACCAGGGCAGAAGTACAGGAGGTA
GGACTTTGTTCTTCCTCATCTGCAATTTCGAGTTTTGTCATCACATTACTCGAGCGTTATCAGCAGCGTGTCGTCCTTCTTTTAAGCTTGTCCATGTAGACATGAATGGTACTTCCGGCT
CACTAGCGAGATGATGCATCGGTTGTAGCTAAGAAAGAATGAACTGTTTCGTTTTACCGACACTTTGGAGCTTCACCAATGTCTTGATTTCAGCTTCTGATGCTCAGTGCATCAGCTAAC
AAGTTGTCGAAGCTGAAAGAGCGAGCGGAGGAATACGCCTCCCTGATCATGGAGGAACTGGACCCGGAGAACCTCGGCTACATCGAG
GTAAAAGCCCCTGAAGCGGCAAAGCAAAACATA
GATGACATAGGATATTCAACTTAGGAAAACTCTTTGCTCCATGGAAAGAAGTACTAATTCAGACAGCCTATCATTTGCCCTGTCCTCTGTTTCAGTTGTGGCAACTGGAGACTCTGCTTC
TGCAAAAGGACACTTATATGAACTACAGCCGAACGCTCAGCACGACCAGTCTTGGCTGGAGCCAAAACCTGAGCTCGTTTAGACCGACCGACAAGGTGCGGAGGATTTGCAGCTCCCTCC
GATGCCTCGTGCTGGAGAACTGGCAAAGAGGTTGGATTCTGTTGCTTTGGGCGATAGTGATGGGGTGCCTCTTCGCTTGGAAGTTCATCCAGTACAGGAACATGGCAGCATTTCACGTAA
TGGGCTATTGCCTGGCGACGGCCAAGGGGGCAGCAGAAACTCTGAAGCTCAACATGGCTCTCATCCTCCTGCCCGTCTGCCGGAATACCCTGACGTGGCTCCGGTCCACCCGGGCCAGGT
CGTTCATTCCCTTCGATGACAACATAAACTTCCACAAG
GTAAAAGATCTGGCGAAACAAGTAGAAACATCATGCATAGAGTTTTGAAATGTTGGTTCTCAACATCGTATCAATTACTCCT
GGCTGAATTAAATTGGCATGGTTCGAAAACATAGTTTTTCCCAAGAATGGTGAAATTCACTATGGCAGGCAATAGAAATAGAAGATTTAGAAAGAAAGTCTAAAGATTTCAATGGTTGCA
ACTTCCAGGGAATGCAATTCCATTAACATGCATGAGCTAAAGTGCATATGAACATGGCCGAGATATAAAGGAAGTACAGTTGTTCAAAGTGATTATTTCAAGCACTACTGTATTTTAGAC
CAACTATATCTCGTGTATGCAAGAGATAATGGAATGACACTCCAGCACTTTTTTCCCAATGCACAGATAATTGCATGTGCCATAGTCATCGGGATCATCCTTCACGCAGGAGACCATCTA
GCATGTGATTTTCCCCGCCTGGTAAACTCCTCCCCAGAAAAGTTTGCCCTCATATCCTCTGACTTCAATAACAGAAAGCCCACATACACGGACCTTCTATCTGGAGTTGAAGGAGTGACG
GGCATTGCTATGGTGGTTTTGATGGCTATCTCATTCACTCTAGCGACACACCGGTTCAGGAGAAACATAGTAAGGCTACCTGCACCTTTCAACAGATTGACAGGTTTCAATGCATTCTGG
TATTCCCATCACCTGCTAGGTGTGGTCTACGTTTTACTGCTCATCCATGGAACCTTTCTGTACTTGGTGCACGAATGGTACATGAAAACG
GTAAGCAATCCGTCTCATTGTATATGCCGT
AGTTAAGTCAAGACATCAAACTTCATCATGTATTCAATAGCACCGGTACTAATTCAATGCCTTACCTCAGACATGGATGTACATCTCTATTCCATTGTTGCTTTACATACTTGAGAGAAG
CATGCGAGCATGCAGATCAAACCATTATGCAGTTCGAATATTGAAG
GTAATACCTTTCTTATTTCTCTTACATTTCGACTTTTCATTGTTTGATCAAGAAAAAGGACATAATATAATGCA
CAATTGAGAAAAAAATGCATCAGCGTCTTCATGCACGATCTTCGCAAAGTACATTGAGAAATTTGTTTTTCTGAAAAAAGCTAATTTCTTTTGGACTATGCTTGTTCTCTTCAGGTTTCG
GTTCTACCAGGGAATGTCTTCAGCATAATCATGTCCAAGCCTCAAGGGTTCAAGTACAGAAGCGGGCAGTACATTTTTCTACAATGTCCGACAATTTCCCCTTTTGAGTG
GTAAAGTCCA
AAACTCATCTCACCTCCTAGCTTTTCCAACATCTGCATTTCCACCATCAAAGGCTAAGTGCTGATACCTTCCAGGCACCCATTCTCAATTACTTCAGCACCTGGAGATGACTACCTCAGT
GTTCACATCAGGACAGTTGGTGATTGGACACAGGAGTTGAAAAAAACTCTCACTGAAGGCAGAGACTCGTCATGTGTCATTGGCCGAGCAAAATTCACATCGGTTGGTTGTATCAATCAG
ACAGG
GTAATTATGTTTCTGGCAGGCTTAAGTTCCGAAATAGAAACTATTCTAGGTAATGCTAACTGAACAAACTGTCATGTCATGATGCAGCCAACCCAAATTGCTCGTCGATGGTCCA
TATGGAGCTCCAGCTCAGGACTACAGAAATTATGATGTACTGCTCCTCGTGGGGCTTGGCATTGGTGCAACCCCTTTTGTAAGCATCCTTAGAGATCTTCTGAGTAATACAAGAGCAGAG
GAGCAAATG
GTACAGTATGTTGCTAATATATGAACAACGTGTCTTAAAATTTAGGAAACACATCCTAAACTTTTGCTATTGTGATGAACTAGGATTCAATCACAGAGACCAGTAGATCTG
ATGATAGCACAAATAGTTTCGCATCTTCAAACGTGACACCAGGCAGCAAAAGAAAGTCACAGAGGACGTCCAGTGCTCATTTCTACTGGGTGACTAGGGAATCTGGGTCGTTCGAGTGGT
TCAAAGGAGTCATGAATGAAGTTGCAGAAATGGATCACAAA
GTAAAATTCTTCTGAACATTGCTCATGACTGTTTAGTGCACGTGTAGAAGGAACTAAACGAGTGGGCTAAGAGACCCTA
TGTCTTCTCTCTCTTTCTGTATGAGCAGGGTCAAATTGAGCTTCACAATCACCTTACCAGTGTCTATGAAGAGGGAGATGCAAGGTCAACTCTAATCACCATGGTCCAGGCTCTCAATCA
TGCCAAACACGGTTTCGACATCCTATCAGGCACACGG
GTATAATATGATGTCTACATAACAATGCCACATTCCGTTACGTTACCATGTTAACAATGAACACGCTACCGAGACAATTGACT
AGAGACACTATAGATAGAATATTCTTCTCTATTTTTTAGCTCGTTTGTTAAAGTGAACTGCTTCAACCGTGAGGCTGCTAACTCAGTCCTGATATTCGATACTTGCAGGTAAGAACACAC
TTTGGAAGACCGAATTGGAGAGAGGTATTTATCAAAGTAGCTTCAAAGCATCCATACACTACAGTAG
GTAAGTGTAAAACAAGAAAGCATTAGTACTTGCTGACAAATTTCATAACAATC
AAACTAAGTAGTTCAGATCCCAGATACAATGAAATTACAAAAACTAGCTTCATTTGTTGCTGGTAATTAATCCTGAAATCATCATACAGGTAGAGCTCAGCACAATAGCCTTCTGATATT
AACAATAACTAGACAAGACTTACAAATTGACATTAGGTCAGATGTAACTTCTGCAAATAAGAGACTTGTTTTTAAACTTGTAGGAGACCCTTAAACGCACTCTGTGGCCAAGTCTACATC
AGAAAATAATGCGAAGGATCAAAATATAAGATCTTAACTTTTGCGTAAATTATATAATAAAACCCTTGACTAGGAAAGTAAAACCATCTCCTTAACGTAATGAAACTCTACAATGTTTGC
TGAATCTGCAACTGTCGCAAGATACTGACGTTCCAATGATGTCTGAACGAAAGGGGTTTTTCTATTGCAGGGGTGTTCTACTGCGGGATGCCGATGTTAGCAAAGGAATTAAGGAAGCTA
TCGCATGAGCTGAGTCACAAGACATCTACACGTTTCGAATTCCACAAGGAGCTTTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGTCGAAGCGGTCCAGCTACAGCCGCGGGTTCGACTTGCCCGAGGAGTTTGACGACGAGGAGGACGAGGCGGCCGCTGCCGCCGACTACGGCAGCGTCGGCGGGGCAATGCTGCCC
GTGTTCCTCAACGACCTGCGGCAGAACTCGCAGCAGGACCTCGTGGAGGTCACCCTCGAGCTCGAGGACGACTCCATCGTCGTCCGCAGCGTCACTCCGACGAGCAACAACAACCTGGCG
TTCTCCGCGGCCGCCGACGAAAACCCCGATCCCGCGGCGGCGGCGGCGGCGCTGGACAGGAACCTGTCGGTCACGACGAGGATCCGGAGGAAGTTCCCGTGGCTGCGGTCCGGGTCGTCG
CGGGCCGGCTCGGAGGCGGAGGCCCCGACGGCGGCGGCGGCCGCGAGGGAGGCGCGGAGGGCGAGGGCGCAGCTGGACCGGAGCCGGTCGAGCGCGCAGAGGGCGCTGAAGGGTCTCCGG
TTCATCAGCAAGGCCAACTTCTGCGCCAGGGACGCCGAGGAGCTCTGGCGCCAGGTCGAGGCCCGCTTCCACCGCCTCGCCAGGGACGGCCTGCTCGCCCGCGAGGACTTCGGCGAATGC
ATCG
GGATGGACTCGAAGGAGTTCGCGGTGGGGATGTTCGACGCGCTGGCGCGGCGGCGGCGGCAGAGGATCGGGAAGATCACCAGGGAGGAGCTGCACGACTTCTGGCTCCAAATCTCC
GACCAGAGCTTCGACGCGCGGCTTCAAATATTCTTCGACAT
GGCGGACAGCAATGAAGATGGGAGAATCACCAGGGCAGAAGTACAGGAGCTTCTGATGCTCAGTGCATCAGCTAACAAG
TTGTCGAAGCTGAAAGAGCGAGCGGAGGAATACGCCTCCCTGATCATGGAGGAACTGGACCCGGAGAACCTCGGCTACATCGAG
TTGTGGCAACTGGAGACTCTGCTTCTGCAAAAGGAC
ACTTATATGAACTACAGCCGAACGCTCAGCACGACCAGTCTTGGCTGGAGCCAAAACCTGAGCTCGTTTAGACCGACCGACAAGGTGCGGAGGATTTGCAGCTCCCTCCGATGCCTCGTG
CTGGAGAACTGGCAAAGAGGTTGGATTCTGTTGCTTTGGGCGATAGTGATGGGGTGCCTCTTCGCTTGGAAGTTCATCCAGTACAGGAACATGGCAGCATTTCACGTAATGGGCTATTGC
CTGGCGACGGCCAAGGGGGCAGCAGAAACTCTGAAGCTCAACATGGCTCTCATCCTCCTGCCCGTCTGCCGGAATACCCTGACGTGGCTCCGGTCCACCCGGGCCAGGTCGTTCATTCCC
TTCGATGACAACATAAACTTCCACAAG
ATAATTGCATGTGCCATAGTCATCGGGATCATCCTTCACGCAGGAGACCATCTAGCATGTGATTTTCCCCGCCTGGTAAACTCCTCCCCAGAA
AAGTTTGCCCTCATATCCTCTGACTTCAATAACAGAAAGCCCACATACACGGACCTTCTATCTGGAGTTGAAGGAGTGACGGGCATTGCTATGGTGGTTTTGATGGCTATCTCATTCACT
CTAGCGACACACCGGTTCAGGAGAAACATAGTAAGGCTACCTGCACCTTTCAACAGATTGACAGGTTTCAATGCATTCTGGTATTCCCATCACCTGCTAGGTGTGGTCTACGTTTTACTG
CTCATCCATGGAACCTTTCTGTACTTGGTGCACGAATGGTACATGAAAACG
ACATGGATGTACATCTCTATTCCATTGTTGCTTTACATACTTGAGAGAAGCATGCGAGCATGCAGATCA
AACCATTATGCAGTTCGAATATTGAAG
GTTTCGGTTCTACCAGGGAATGTCTTCAGCATAATCATGTCCAAGCCTCAAGGGTTCAAGTACAGAAGCGGGCAGTACATTTTTCTACAATGT
CCGACAATTTCCCCTTTTGAGTG
GCACCCATTCTCAATTACTTCAGCACCTGGAGATGACTACCTCAGTGTTCACATCAGGACAGTTGGTGATTGGACACAGGAGTTGAAAAAAACTCTC
ACTGAAGGCAGAGACTCGTCATGTGTCATTGGCCGAGCAAAATTCACATCGGTTGGTTGTATCAATCAGACAGG
CCAACCCAAATTGCTCGTCGATGGTCCATATGGAGCTCCAGCTCAG
GACTACAGAAATTATGATGTACTGCTCCTCGTGGGGCTTGGCATTGGTGCAACCCCTTTTGTAAGCATCCTTAGAGATCTTCTGAGTAATACAAGAGCAGAGGAGCAAATG
GATTCAATC
ACAGAGACCAGTAGATCTGATGATAGCACAAATAGTTTCGCATCTTCAAACGTGACACCAGGCAGCAAAAGAAAGTCACAGAGGACGTCCAGTGCTCATTTCTACTGGGTGACTAGGGAA
TCTGGGTCGTTCGAGTGGTTCAAAGGAGTCATGAATGAAGTTGCAGAAATGGATCACAAA
GGTCAAATTGAGCTTCACAATCACCTTACCAGTGTCTATGAAGAGGGAGATGCAAGGTCA
ACTCTAATCACCATGGTCCAGGCTCTCAATCATGCCAAACACGGTTTCGACATCCTATCAGGCACACGG
GTAAGAACACACTTTGGAAGACCGAATTGGAGAGAGGTATTTATCAAAGTA
GCTTCAAAGCATCCATACACTACAGTAG
GGGTGTTCTACTGCGGGATGCCGATGTTAGCAAAGGAATTAAGGAAGCTATCGCATGAGCTGAGTCACAAGACATCTACACGTTTCGAATTC
CACAAGGAGCTTTTCTGA

Retrieve as FASTA