Entry information : EgrRboh06 ( Eucgr.J02107 / Egrandis_v1_0.048935m)
Entry ID 10179
Creation 2012-01-25 (Qiang Li)
Last sequence changes 2012-01-25 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-16 (Christophe Dunand)
Peroxidase information: EgrRboh06 ( Eucgr.J02107 / Egrandis_v1_0.048935m)
Name (synonym) EgrRboh06 ( Eucgr.J02107 / Egrandis_v1_0.048935m)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrRboh06
start..stop
S start..stop
EglRboh06 1788 0 1..857 1..857
EguRboh06 1776 0 1..857 1..857
EcamRboh06 1761 0 1..857 1..857
VvRboh08 1256 0 3..857 11..843
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 27020495..27020864 370 N° 2 27020968..27021130 163 N° 3 27021201..27021249 49 N° 4 27021343..27021456 114
N° 5 27021555..27022361 807 N° 6 27022637..27022732 96 N° 7 27022823..27022938 116 N° 8 27023039..27023141 103
N° 9 27023264..27023355 92 N° 10 27023435..27023645 211 N° 11 27023677..27023811 135 N° 12 27023944..27024072 129
N° 13 27024147..27024225 79 N° 14 27024333..27024442 110  
join(27020495..27020864,27020968..27021130,27021201..27021249,27021343..27021456 ,27021555..27022361,27022637..27022732,27022823..27022938,27023039..27023141,270 23264..27023355,27023435..27023645,27023677..27023811,27023944..27024072,2702414 7..27024225,27024333..27024442)


exon

Literature and cross-references EgrRboh06 ( Eucgr.J02107 / Egrandis_v1_0.048935m)
DNA ref. Phytozome 11:   scaffold_10 (27020495..27024442)
Protein sequence: EgrRboh06 ( Eucgr.J02107 / Egrandis_v1_0.048935m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   857
PWM (Da):   %s   98246.56 Transmb domain:   %s   o290-308i423-445o471-493i659-676o
PI (pH):   %s   9.78
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGDSSKWILESIEVDDMADVPLDSSNKSGVHSGGPTSKVNDEAMLARSSSSTRKRVGFQGTRPPALSRMGRTESGARRGLKSLRFLDRTITGKEVDAWKSMEKRFNQFAVDGRISKDKFGTCIGMGESKEFAGELFETLARRRKIHSENGITQEEMRAFWDDMTNQDIDSRLQIFFDMCDKNGDGKLSEEEVKVIILSASANKLSNLKQQAASYAVLIMEELDPDHLGYIEMWQLETLLREMVSSEEANKLAKKTHTLARTMIPRQYRTPISKFLLKTFEFLQENWKRVWVMSLWLTLNLILFVWKFRQYKERDIFQVMGYCVCFAKGAAETLKFNMALILIPVCRRTLTKLRSTALSRIFPFDDNINFHKSIALAIVIGTSIHIIMHLSCDFPRLISCPKPKFLRYAGPNFNYKQPSYLDLVESVPGVTGIIITILMAFSFTLATHSFRRNVIKLPWPFHHLAGFNAFWYAHHLLFLVYALLIVHGYFLFLSRHWYSKSTWMYLSVPLLLYVSERIFTAIDERNHRVNVIKAIIYTGNVLALYISKPPGFKYKSGMYMFVKCPDISNFEWHPFSITSAPGDDYLSVHIRTLGDWTTELKNRFAVCEPPNEPAGRGSLVRLQTKAISDYDHTQVRFPRILIKGPYGAPAQNYKKYDILFLIGLGIGATPFISILKDLLNQIKPNEQNNVSQKFITSNKFSRCRRDPGQSIPGANKKAPERAYFYWVTREQGSFEWFKGVMDDIAEYDHNHIIEMHNYLTSVYEEGDARSALIAMVQKLQHAKNGVDVVSESRIRTHFARPNWRKVFSQLASAHPSSRIGVFYCGSPTLTKPLKKLCQEFSLNSSTRFQFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (scaffold_10, 13 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGGACTCCTCTAAATGGATTCTGGAAAGCATCGAGGTCGACGACATGGCCGATGTGCCCTTGGACAGCTCCAACAAAAGCGGCGTTCATAGCGGCGGCCCGACTTCCAAGGTGAAC
GATGAGGCAATGCTCGCCCGGAGCTCGAGCAGCACGAGGAAGCGAGTTGGGTTTCAGGGCACTAGGCCACCGGCGTTGTCTAGGATGGGAAGGACCGAATCCGGTGCCAGGAGAGGGCTC
AAGAGCTTGAGGTTCTTGGACAGGACCATCACAGGGAAGGAGGTGGACGCTTGGAAGTCCATGGAGAAACGTTTCAACCAATTCGCAGTCGATGGGAGGATCTCGAAGGACAAGTTCGGG
ACCTGCATTG
GTAATTCGACGCTGACTTGGAAACCCCAAGACGGGGTCCTGCTTGAAATCTAACTTTTCCTGGGGAAAAAAGAGCTCAGGGGTTGTGAAATGCTGTGTTGCAGGAATGGG
AGAATCCAAGGAATTTGCGGGGGAGCTGTTTGAGACATTGGCGAGGCGTAGGAAGATACACTCGGAGAACGGGATTACTCAGGAGGAAATGAGGGCATTTTGGGACGATATGACTAACCA
GGACATTGACTCACGCCTTCAAATCTTCTTTGACAT
GTAAAGAATTGTGCTTTCTGTGTCTCTTGGTTGTGTTGTTCACAGGAAACTAACTTCGCTAGTGTTTCAGGTGTGACAAAAATG
GCGATGGTAAGCTCTCCGAGGAGGAGGTGAAGGAG
GTGAGAGATAGCAACTTCCCAAAATCTCCTCTTCTTGTGTTTTTGGACGCTAATGGATAAAATTCTTTTACCTTTTAATTCTGGC
AAGTGAAGGTAATCATATTGAGCGCTTCAGCAAACAAGCTGTCCAATCTCAAGCAGCAAGCCGCATCCTATGCTGTGTTGATCATGGAAGAGCTCGATCCTGACCATCTCGGGTATATCG
AA
GTGAGTAGAAGTCTAGAGCCATTCCTTGAGAAGAGCATGTTTGTGTGTTCATCTATCGAGTCCTCTCTCTCTCTTCCTAATTTTGCAAGCTTAAGCAGATGTGGCAACTCGAGACTCT
ACTGAGGGAGATGGTGAGCTCCGAAGAAGCCAACAAGCTGGCCAAAAAAACCCACACTCTTGCAAGGACCATGATTCCGAGACAATATAGGACTCCGATCAGCAAATTTTTATTGAAAAC
CTTCGAATTTCTCCAGGAGAATTGGAAGAGAGTGTGGGTCATGTCACTTTGGTTGACTCTAAATTTGATCCTTTTTGTCTGGAAGTTCCGTCAATACAAGGAGAGAGACATATTTCAAGT
CATGGGTTACTGTGTTTGTTTTGCGAAGGGCGCTGCTGAGACGCTCAAATTCAACATGGCCCTTATTCTCATCCCTGTGTGTAGGAGGACGCTTACTAAACTTAGATCAACTGCCCTAAG
TAGGATATTTCCTTTCGACGACAATATTAATTTCCACAAGTCGATAGCACTGGCAATAGTAATCGGGACTTCAATACATATTATTATGCACCTTTCGTGTGATTTCCCAAGACTAATTTC
ATGTCCTAAGCCAAAGTTTTTGAGGTACGCGGGGCCTAACTTCAATTACAAGCAGCCAAGTTACTTGGATCTAGTTGAGAGCGTTCCTGGTGTTACCGGGATTATAATTACCATCTTGAT
GGCTTTCTCTTTCACACTGGCCACGCATTCATTTAGAAGGAATGTCATCAAGTTACCTTGGCCATTCCACCATCTAGCCGGGTTCAATGCCTTCTGGTACGCTCACCATTTGCTGTTCCT
GGTCTATGCTCTCTTGATAGTGCACGGCTACTTCCTGTTTCTGAGTAGGCACTGGTACTCAAAAAGT
GTAAGTATGATTTATGCACTTGAACTAAATCATTTTATTTGTTCATAGATTTG
TCAGATGATTTTACTGCGACGACAGAACTGTTTCTGCTTAACAATGTGTTTGTATTCAATGCTATGCTTAACATGTCATCTTTGGTTCATTGCATATTCGAATTTCATTGAACGTGTTCT
TGAGCTTAAAATGCCTTATAACTTTGTCAAGTGATATTGCTGTCTTAGTTTCATGCTGATGAAAGAAAGCTATTATGAACTGTTAAATTTCTTCCTGTGCAGACATGGATGTATCTCTCT
GTTCCTTTATTACTTTATGTCAGCGAGAGAATTTTCACAGCTATTGACGAGCGCAACCATCGTGTCAATGTTATCAAG
GTCAGCAATCATAGAGCTCTCCTGCCTTCAATTCTCAAGTCC
CAGGAACATGTATAAGTGCTTATGAACTGAATACATGAGTTATTGCAGGCAATCATATACACAGGAAATGTTTTGGCGTTGTACATAAGCAAACCCCCAGGATTCAAGTATAAAAGCGGA
ATGTATATGTTTGTCAAGTGTCCAGATATTTCCAACTTCGAGTG
GTAATGCATTGCTTTACTCAACAACAGGCTAAACCAAGTCTGTTAGTTGCTAGCTGCACATTTTTATGAATTGAGC
TGATTGATTTGTCACTTGTCATAGGCATCCTTTTTCTATCACTTCCGCACCAGGAGATGACTACTTGAGTGTCCACATACGAACCTTGGGAGACTGGACCACGGAGCTTAAGAACAGATT
TGCACAG
GTTAACAGATTATGGTGCTATGGCTAGAAGTTTATCTACTATAACGCACTACTGCTTGCTTCTTGATCTTAAATGTCTCACTTTCTGTTTCCACTTTTAAGTGCTAAGTCGAA
GAATTGCAGGTTTGTGAGCCACCGAACGAGCCAGCGGGAAGGGGAAGTCTAGTGAGGCTTCAAACCAAGGCAATCTCAGATTATGATCACACACAAGTCAGGTGGAGCAAAGTTTTGGTG
ATCTCGTTTTGTGGCTTCAATGATGTTGTTAAATCTCATAATTTCTCCTCAATTTTATAGATTCCCGAGAATCCTCATTAAGGGACCGTATGGAGCCCCAGCTCAGAACTACAAAAAGTA
CGACATCCTTTTCCTTATCGGTCTAGGGATCGGGGCAACACCATTTATCAGCATTTTGAAGGACCTCCTCAACCAGATCAAGCCGAACGAACAAAACAATGTGAGCCAAAAGTTTATAAC
TTCAAACAAGTTTAGCAGATGTAGGAGACAA
GTAGTAAACAGGATGATTTGACCACTTGCAGGATCCTGGACAAAGCATACCAGGTGCAAATAAGAAGGCACCGGAAAGAGCATACTTTT
ATTGGGTAACAAGGGAACAGGGTTCGTTTGAATGGTTCAAAGGTGTGATGGATGATATCGCAGAATACGACCATAAT
GTAAGTTCCAAAACAATGGAAAACATGCTTCATGACCACCTCG
CCTTCTTACGTTTACACTCATTCTTGTAGTAGCACATCCTCTTCTGTTTATATCATTCTCACTGTTTATTGGTCTAATGAGCTGAGCAGCATATAATAGAGATGCACAACTACTTGACTA
GTGTATATGAAGAAGGAGATGCACGGTCAGCACTCATCGCAATGGTGCAGAAGCTGCAGCATGCAAAGAATGGAGTGGATGTTGTCTCAGAAAGCCGG
GTATATGCCTCTAGTTATTATT
CCTCTGATCATTTAATTCATGTCTGGCTCATTTCTGACATACGTGCGCACAGATAAGAACGCATTTTGCGAGGCCTAACTGGAGAAAGGTGTTCTCCCAACTGGCAAGTGCTCATCCTTC
TTCTCGAATAG
GTACTGGTTTTGATTTGCGGCCATGGAGAAATGTCAAAATGCACTTAACTGATGAGATTGTTCTCATTCTGGCTCTTGCCTCTAATGTGGATGTTGGGCCCTTGCAGGT
GTTTTCTACTGTGGAAGTCCAACGCTTACTAAGCCGTTAAAGAAGCTTTGTCAAGAATTCAGCCTAAACTCATCGACCCGTTTCCAATTTCACAAGGAAAACTTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGGACTCCTCTAAATGGATTCTGGAAAGCATCGAGGTCGACGACATGGCCGATGTGCCCTTGGACAGCTCCAACAAAAGCGGCGTTCATAGCGGCGGCCCGACTTCCAAGGTGAAC
GATGAGGCAATGCTCGCCCGGAGCTCGAGCAGCACGAGGAAGCGAGTTGGGTTTCAGGGCACTAGGCCACCGGCGTTGTCTAGGATGGGAAGGACCGAATCCGGTGCCAGGAGAGGGCTC
AAGAGCTTGAGGTTCTTGGACAGGACCATCACAGGGAAGGAGGTGGACGCTTGGAAGTCCATGGAGAAACGTTTCAACCAATTCGCAGTCGATGGGAGGATCTCGAAGGACAAGTTCGGG
ACCTGCATTG
GAATGGGAGAATCCAAGGAATTTGCGGGGGAGCTGTTTGAGACATTGGCGAGGCGTAGGAAGATACACTCGGAGAACGGGATTACTCAGGAGGAAATGAGGGCATTTTGG
GACGATATGACTAACCAGGACATTGACTCACGCCTTCAAATCTTCTTTGACAT
GTGTGACAAAAATGGCGATGGTAAGCTCTCCGAGGAGGAGGTGAAGGAGGTAATCATATTGAGCGCT
TCAGCAAACAAGCTGTCCAATCTCAAGCAGCAAGCCGCATCCTATGCTGTGTTGATCATGGAAGAGCTCGATCCTGACCATCTCGGGTATATCGAA
ATGTGGCAACTCGAGACTCTACTG
AGGGAGATGGTGAGCTCCGAAGAAGCCAACAAGCTGGCCAAAAAAACCCACACTCTTGCAAGGACCATGATTCCGAGACAATATAGGACTCCGATCAGCAAATTTTTATTGAAAACCTTC
GAATTTCTCCAGGAGAATTGGAAGAGAGTGTGGGTCATGTCACTTTGGTTGACTCTAAATTTGATCCTTTTTGTCTGGAAGTTCCGTCAATACAAGGAGAGAGACATATTTCAAGTCATG
GGTTACTGTGTTTGTTTTGCGAAGGGCGCTGCTGAGACGCTCAAATTCAACATGGCCCTTATTCTCATCCCTGTGTGTAGGAGGACGCTTACTAAACTTAGATCAACTGCCCTAAGTAGG
ATATTTCCTTTCGACGACAATATTAATTTCCACAAGTCGATAGCACTGGCAATAGTAATCGGGACTTCAATACATATTATTATGCACCTTTCGTGTGATTTCCCAAGACTAATTTCATGT
CCTAAGCCAAAGTTTTTGAGGTACGCGGGGCCTAACTTCAATTACAAGCAGCCAAGTTACTTGGATCTAGTTGAGAGCGTTCCTGGTGTTACCGGGATTATAATTACCATCTTGATGGCT
TTCTCTTTCACACTGGCCACGCATTCATTTAGAAGGAATGTCATCAAGTTACCTTGGCCATTCCACCATCTAGCCGGGTTCAATGCCTTCTGGTACGCTCACCATTTGCTGTTCCTGGTC
TATGCTCTCTTGATAGTGCACGGCTACTTCCTGTTTCTGAGTAGGCACTGGTACTCAAAAAGT
ACATGGATGTATCTCTCTGTTCCTTTATTACTTTATGTCAGCGAGAGAATTTTCACA
GCTATTGACGAGCGCAACCATCGTGTCAATGTTATCAAG
GCAATCATATACACAGGAAATGTTTTGGCGTTGTACATAAGCAAACCCCCAGGATTCAAGTATAAAAGCGGAATGTATATG
TTTGTCAAGTGTCCAGATATTTCCAACTTCGAGTG
GCATCCTTTTTCTATCACTTCCGCACCAGGAGATGACTACTTGAGTGTCCACATACGAACCTTGGGAGACTGGACCACGGAGCTT
AAGAACAGATTTGCACAG
GTTTGTGAGCCACCGAACGAGCCAGCGGGAAGGGGAAGTCTAGTGAGGCTTCAAACCAAGGCAATCTCAGATTATGATCACACACAAGTCAGATTCCCGAGA
ATCCTCATTAAGGGACCGTATGGAGCCCCAGCTCAGAACTACAAAAAGTACGACATCCTTTTCCTTATCGGTCTAGGGATCGGGGCAACACCATTTATCAGCATTTTGAAGGACCTCCTC
AACCAGATCAAGCCGAACGAACAAAACAATGTGAGCCAAAAGTTTATAACTTCAAACAAGTTTAGCAGATGTAGGAGACAA
GATCCTGGACAAAGCATACCAGGTGCAAATAAGAAGGCA
CCGGAAAGAGCATACTTTTATTGGGTAACAAGGGAACAGGGTTCGTTTGAATGGTTCAAAGGTGTGATGGATGATATCGCAGAATACGACCATAAT
CATATAATAGAGATGCACAACTAC
TTGACTAGTGTATATGAAGAAGGAGATGCACGGTCAGCACTCATCGCAATGGTGCAGAAGCTGCAGCATGCAAAGAATGGAGTGGATGTTGTCTCAGAAAGCCGG
ATAAGAACGCATTTT
GCGAGGCCTAACTGGAGAAAGGTGTTCTCCCAACTGGCAAGTGCTCATCCTTCTTCTCGAATAG
GTGTTTTCTACTGTGGAAGTCCAACGCTTACTAAGCCGTTAAAGAAGCTTTGTCAA
GAATTCAGCCTAAACTCATCGACCCGTTTCCAATTTCACAAGGAAAACTTCTAG

Retrieve as FASTA