Entry information : EgrRboh03 ( Eucgr.F02491 / Egrandis_v1_0.045742m)
Entry ID 10180
Creation 2012-01-25 (Qiang Li)
Last sequence changes 2012-01-25 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-16 (Christophe Dunand)
Peroxidase information: EgrRboh03 ( Eucgr.F02491 / Egrandis_v1_0.045742m)
Name (synonym) EgrRboh03 ( Eucgr.F02491 / Egrandis_v1_0.045742m)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus grandis    [TaxId: 71139 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EgrRboh03
start..stop
S start..stop
EglRboh03 1651 0 13..798 29..814
EguRboh03 1618 0 1..798 1..798
EgrRboh06 1147 0 13..798 51..857
EglRboh06 1145 0 13..798 51..857
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 34547463..34547497 35 N° 2 34548047..34548255 209 N° 3 34548369..34548531 163 N° 4 34548633..34548681 49
N° 5 34548763..34548876 114 N° 6 34548958..34549764 807 N° 7 34549891..34549986 96 N° 8 34550089..34550204 116
N° 9 34550296..34550398 103 N° 10 34550537..34550628 92 N° 11 34550712..34550871 160 N° 12 34550957..34551091 135
N° 13 34551192..34551320 129 N° 14 34551416..34551494 79 N° 15 34551648..34551757 110  
join(34547463..34547497,34548047..34548255,34548369..34548531,34548633..34548681 ,34548763..34548876,34548958..34549764,34549891..34549986,34550089..34550204,345 50296..34550398,34550537..34550628,34550712..34550871,34550957..34551091,3455119 2..34551320,34551416..34551494,34551648..34551757)


exon

Literature and cross-references EgrRboh03 ( Eucgr.F02491 / Egrandis_v1_0.045742m)
DNA ref. Phytozome 11:   scaffold_6 (34547463..34551757)
Protein sequence: EgrRboh03 ( Eucgr.F02491 / Egrandis_v1_0.045742m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   798
PWM (Da):   %s   91670.82 Transmb domain:   %s   i245-264o331-353i381-403o429-451i617-634o
PI (pH):   %s   9.95
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNMLLHKTQVIGTTRKRNVSYGGIPRMERTASSASRGLMSLRFLDRTITGKEGDAWRSIEKRFHQHATNGQLSRDKFGVCGMGDSKEFAGELFDALSRRRKVNAENGISIDQLRQFWEDMTTRELESRLQIFFDMCDKNGDGRLTEDEVKVIVLSAASNRLSNLQQQAASHASLIMERLDPDHQGYIEMWQLKTLLREMVNPDQRSKSSVNSQNLTRTMLPKGYRNPMSRLVHKNIERIHDNWRRIWVVGLWLVANMILFLWKFNKTRHGPAFDITGYCLCYAKGSAETLNLNMALVLLPVCRRTLTKLRSSFLGTFIPFDDNINFHKIIALAIAIGSVVHIAMHFMCNFPRITSCPKSQFKQVFGPYFHNRQPHYIDLVNNLSSTTGVLMFMMMAFSFTLATHWFRRNIIKLPWGLHHLAGFNAFWYAHHLLAVAYVFFILHGYFLVISRPWYTKTAWMYVMVPILLYTSERAFTSASELQHRVDIVKAIVYSGNVLALYMSKPPGFNYNSGMYLFVKCPDISKFEWHPFSITSAPGDAFLSVHMRALGDWTTELRNRFAVCEPPSKKPGKGGLTKMATRTSHNLEELQEKFPKIFIKGPYGAPAQDYEKYDILLLIGLGIGATPFISIIKDILNHVKLNKLQDSDQDQSSGARKGPKRAYFYWVTREQNSFEWFKGVMDDIAERDDHNVIEMHNYLTSLYEEGDARSALIAMVQKLQHAKNGVDIFSESQIKTHFARPNWRKVFSEIAMRHKSSRIGVFYCGSSVLTKTLRKLCQELSLESSTRFQFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (scaffold_6, 14 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATATGCTTCTGCACAAAACGCAGGTTATTGGGTAAGTTAAATTTTTTTTTTTTAGTACAAGGTATCGTAAGTTGTCCCATGGAAATTGCCGTTTTTGTAGTATTTTTACATTGGAA
AAACATAATTTTTGTTTTCGGTTGATCTTATGAGATGTTTAAGAATCGGTTGGCTTTCCAGTTACGTGGTGCAACGGCATTACTTTCAGGGGTGGTCAAAAAACAATTCCAGGTACAAAA
AAGTGTTCCTCCATTGTAATGGTGTGCGTTGGTTACAATTGTTCTTGTTTCATTTCCTATCTTTAGGCTTTCCTCTTCCTCTTCCGCCTCTTAAAACTCACCATCTTTACTTCTCTTTTC
ATCTTTCATCCTCATACTTTTCCCAGTTACCCGAACCCTCGGAGGGAATACACCCAAAACCACAAATTGTTCATAGTTGCAATGAGGGTTCATCATGACCGTAACGGGAGTTCCGCTAGA
TGCTCTCTTGAAAGCATTGAGATGGACAATGCGGTGGAAACCAGTGAGAGCTCCGCCCCGCCGCATCCTAATGACATACCATTGCCATCGAGGCGGAACTCAAGCACGACGCGGAAGAGG
AATGTATCGTACGGCGGCATCCCTAGGATGGAAAGAACGGCATCCAGTGCCTCTCGAGGCCTCATGAGCTTGAGGTTTCTGGATAGGACAATTACCGGGAAGGAAGGAGATGCCTGGAGA
TCAATCGAGAAGCGTTTCCATCAACACGCGACGAACGGCCAACTCTCGAGAGACAAATTTGGAGTCTGCATTG
GTTGATCCTTAGAAAGTCTTGCTGCTATCTGAATCATGATTTTCCAG
ATAATAATAATAATAATAATTGCACAATTTGATTGAGAAGTGACATTGTTTTATTCTGCGTGGAAGGAATGGGAGATTCCAAGGAATTTGCAGGAGAGTTATTCGACGCCTTATCAAGAC
GGAGGAAAGTGAATGCCGAGAATGGAATATCAATAGACCAATTGAGACAATTTTGGGAAGACATGACGACTCGAGAACTCGAATCCCGACTGCAGATATTCTTTGATAT
GTAAAGCAACT
CTCGTCCATCTCCTATTATCGTTCGCAACCTAAAGCGTACATTGCGTTGCTGGTAATACATGTGATGAAGTTTCGCGACGAATGCTGCAGGTGTGACAAGAATGGTGATGGGAGGCTAAC
TGAGGATGAGGTAAAAGAG
GTGAGGCAAAAGGAGACTTACTAATCACTCGTTTAGCGTGTCCTTTGGGCTCTTTTATGATGGACTGGAAATTTTTCAAAGGTGATAGTGTTGAGCGCCGC
CTCGAATAGGCTGTCAAATCTCCAGCAGCAAGCGGCATCTCACGCATCTCTGATCATGGAAAGACTTGATCCCGACCATCAAGGATACATCGAG
GTACCGAGTCAGATAGTCCATCATGT
CCTGTTCGAGTTCGTGTTCCTCCCATGTTGTTGTTCATCGCTTCTTTGTTTTCAGATGTGGCAATTAAAGACTCTCCTGAGAGAAATGGTGAACCCTGATCAAAGGAGCAAGTCGTCAGT
GAATTCTCAAAACCTGACCAGAACCATGCTTCCCAAAGGATACAGAAACCCAATGAGTCGGCTCGTGCACAAGAACATCGAAAGGATCCATGACAATTGGAGGCGAATATGGGTCGTCGG
GCTGTGGCTGGTCGCAAACATGATCCTCTTCCTTTGGAAGTTTAACAAAACGAGGCACGGCCCCGCCTTTGACATCACGGGCTATTGTCTTTGCTACGCCAAGGGCTCTGCCGAGACACT
CAATCTCAACATGGCTCTCGTCCTCCTCCCCGTATGCAGAAGAACTCTCACGAAGCTACGCTCGTCCTTCCTTGGTACCTTCATACCATTCGACGACAACATAAACTTCCACAAGATAAT
CGCGCTGGCCATAGCTATAGGATCTGTCGTTCACATTGCAATGCATTTTATGTGCAACTTCCCCAGGATAACTTCCTGCCCAAAATCACAATTCAAGCAAGTGTTTGGCCCGTACTTCCA
TAATAGGCAACCTCATTACATCGACTTGGTCAATAACTTGTCCAGCACCACCGGGGTTCTCATGTTCATGATGATGGCCTTCTCTTTCACACTGGCGACTCATTGGTTCAGGAGAAACAT
CATCAAGCTACCGTGGGGGCTCCATCATTTAGCAGGATTTAATGCCTTCTGGTACGCACATCATTTGCTAGCCGTTGCCTATGTCTTCTTCATACTTCACGGCTACTTCCTCGTGATCAG
TCGACCTTGGTACACGAAAACG
GTAAGTACACAATGGTCTAATTCCTTATTCTGTTCACCATTAATTCATAAGGCCTGAATTCTCCGGTCGTACCATCATTCCTCTGAAAACACGGCAAG
AATCATTATACGGTTGGACTTTATGCAGGCATGGATGTATGTGATGGTCCCAATCCTACTCTACACAAGCGAGAGAGCATTCACATCTGCTTCTGAACTCCAACATCGAGTTGATATCGT
TAAG
GTATCACTCACTTTACCGAACTGCCGTGTTCCACATTCCTTTTTGGTTTACACGAATCTTAGTGCTACGATAAATTCATGCTCGGCTCAAAAAACTTTTCAGGCCATTGTTTATTC
TGGAAACGTCCTTGCATTGTACATGAGCAAGCCTCCAGGTTTCAACTACAACAGCGGAATGTACCTTTTCGTCAAATGCCCTGATATATCAAAGTTCGAATG
GTGTATAGAACATAATCG
CTGAAACCTATTTACTCGTCATACCCCTATGGCTTTTATTGCTGAAACTCATCGGTGTTTTTGCTCGGGACAGGCATCCTTTCTCCATTACTTCCGCACCGGGAGATGCCTTCTTGAGTG
TTCACATGCGAGCCTTGGGCGATTGGACTACAGAGCTCAGGAATAGATTCGCCGAG
GTATATTCTATTGATTTTCTCATTCGTTTTTAGATTGCACAACCCATGGACTCTAGTCGAAAGA
TATAAAAAAATCACCACATTTTCCATGTTGAGTATCGAACTCAATGTTCATCTTCTTCAATGAGAAATTGTTAGGTTTGTGAGCCACCAAGTAAAAAACCAGGGAAGGGAGGTCTAACGA
AGATGGCCACGAGAACATCCCACAACTTGGAAGAGTTACAAGAGAA
GTGAGTGAAAATTATGGCTAAATTCTGTCCCACCCCTTCCATGCAAATGCTTTCGCTCTAACAGATATTCATTG
TTGTCCAAGGTTTCCAAAGATTTTCATCAAGGGGCCATACGGTGCTCCGGCTCAGGACTACGAGAAGTATGACATCCTCCTACTCATCGGTCTTGGCATCGGAGCGACTCCTTTCATCAG
CATCATAAAAGATATCCTGAATCACGTCAAGTTGAATAAGCTCCAAGCA
GTAAGTAGAAAAGGGAAAAACACTCGCACAAGCAATTTCAAATTCAGTTAGCACGACCATTTGCCAAAACT
ATTGATGCATGCAGGATTCGGATCAAGATCAATCATCAGGGGCAAGAAAAGGTCCTAAAAGAGCATACTTTTACTGGGTTACGAGGGAACAAAACTCTTTCGAGTGGTTCAAGGGCGTCA
TGGATGATATTGCAGAAAGAGACGATCAT
GTCGGTTCGCCATTTCCAAAACTACCAAGTGTGATGAATCCTCCAATTAATTATAGTTTTTCAACTAAAATGTCGCTTTGGGTACTGGTGA
TTGTTGTAGAATGTAATAGAGATGCACAACTACCTGACCTCTCTATATGAGGAAGGAGATGCGAGATCAGCACTCATTGCCATGGTCCAAAAGTTGCAGCACGCGAAGAATGGTGTCGAC
ATCTTCTCGGAAAGTCAG
GTAACTCTTGATCAGTCACACAAAAGAAAAACAAAGAAACATTCACAGCACAATGCACCTATTTAGGCTGTCCTTTAACGTTGCTTGTTCGACAGATAAAAA
CTCACTTTGCGAGGCCTAATTGGAGAAAGGTGTTCTCTGAAATTGCAATGCGGCACAAGTCGTCTCGTATAG
GTACGACATCACGTCCGATGAACGTGTCAACATAATGGCACTTGATTT
GGTTGTTCTAGCCAGTTTGGAACATGAACCTGTGATTTTCTAACTGTTGGAACTTGAACATTCTACCAATTCGGGTCTGATATGTCGGTAATAATTTTCCTGCAGGTGTTTTCTATTGTG
GGAGTTCGGTGCTCACCAAAACACTGAGGAAGCTATGTCAAGAACTCAGCCTAGAGTCGTCAACTCGCTTCCAATTCCACAAGGAAAACTTTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATATGCTTCTGCACAAAACGCAGGTTATTGGCACGACGCGGAAGAGGAATGTATCGTACGGCGGCATCCCTAGGATGGAAAGAACGGCATCCAGTGCCTCTCGAGGCCTCATGAGC
TTGAGGTTTCTGGATAGGACAATTACCGGGAAGGAAGGAGATGCCTGGAGATCAATCGAGAAGCGTTTCCATCAACACGCGACGAACGGCCAACTCTCGAGAGACAAATTTGGAGTCTGC
ATTG
GAATGGGAGATTCCAAGGAATTTGCAGGAGAGTTATTCGACGCCTTATCAAGACGGAGGAAAGTGAATGCCGAGAATGGAATATCAATAGACCAATTGAGACAATTTTGGGAAGAC
ATGACGACTCGAGAACTCGAATCCCGACTGCAGATATTCTTTGATAT
GTGTGACAAGAATGGTGATGGGAGGCTAACTGAGGATGAGGTAAAAGAGGTGATAGTGTTGAGCGCCGCCTCG
AATAGGCTGTCAAATCTCCAGCAGCAAGCGGCATCTCACGCATCTCTGATCATGGAAAGACTTGATCCCGACCATCAAGGATACATCGAG
ATGTGGCAATTAAAGACTCTCCTGAGAGAA
ATGGTGAACCCTGATCAAAGGAGCAAGTCGTCAGTGAATTCTCAAAACCTGACCAGAACCATGCTTCCCAAAGGATACAGAAACCCAATGAGTCGGCTCGTGCACAAGAACATCGAAAGG
ATCCATGACAATTGGAGGCGAATATGGGTCGTCGGGCTGTGGCTGGTCGCAAACATGATCCTCTTCCTTTGGAAGTTTAACAAAACGAGGCACGGCCCCGCCTTTGACATCACGGGCTAT
TGTCTTTGCTACGCCAAGGGCTCTGCCGAGACACTCAATCTCAACATGGCTCTCGTCCTCCTCCCCGTATGCAGAAGAACTCTCACGAAGCTACGCTCGTCCTTCCTTGGTACCTTCATA
CCATTCGACGACAACATAAACTTCCACAAGATAATCGCGCTGGCCATAGCTATAGGATCTGTCGTTCACATTGCAATGCATTTTATGTGCAACTTCCCCAGGATAACTTCCTGCCCAAAA
TCACAATTCAAGCAAGTGTTTGGCCCGTACTTCCATAATAGGCAACCTCATTACATCGACTTGGTCAATAACTTGTCCAGCACCACCGGGGTTCTCATGTTCATGATGATGGCCTTCTCT
TTCACACTGGCGACTCATTGGTTCAGGAGAAACATCATCAAGCTACCGTGGGGGCTCCATCATTTAGCAGGATTTAATGCCTTCTGGTACGCACATCATTTGCTAGCCGTTGCCTATGTC
TTCTTCATACTTCACGGCTACTTCCTCGTGATCAGTCGACCTTGGTACACGAAAACG
GCATGGATGTATGTGATGGTCCCAATCCTACTCTACACAAGCGAGAGAGCATTCACATCTGCT
TCTGAACTCCAACATCGAGTTGATATCGTTAAG
GCCATTGTTTATTCTGGAAACGTCCTTGCATTGTACATGAGCAAGCCTCCAGGTTTCAACTACAACAGCGGAATGTACCTTTTCGTC
AAATGCCCTGATATATCAAAGTTCGAATG
GCATCCTTTCTCCATTACTTCCGCACCGGGAGATGCCTTCTTGAGTGTTCACATGCGAGCCTTGGGCGATTGGACTACAGAGCTCAGGAAT
AGATTCGCCGAG
GTTTGTGAGCCACCAAGTAAAAAACCAGGGAAGGGAGGTCTAACGAAGATGGCCACGAGAACATCCCACAACTTGGAAGAGTTACAAGAGAAGTTTCCAAAGATTTTC
ATCAAGGGGCCATACGGTGCTCCGGCTCAGGACTACGAGAAGTATGACATCCTCCTACTCATCGGTCTTGGCATCGGAGCGACTCCTTTCATCAGCATCATAAAAGATATCCTGAATCAC
GTCAAGTTGAATAAGCTCCAAGCA
GATTCGGATCAAGATCAATCATCAGGGGCAAGAAAAGGTCCTAAAAGAGCATACTTTTACTGGGTTACGAGGGAACAAAACTCTTTCGAGTGGTTC
AAGGGCGTCATGGATGATATTGCAGAAAGAGACGATCAT
AATGTAATAGAGATGCACAACTACCTGACCTCTCTATATGAGGAAGGAGATGCGAGATCAGCACTCATTGCCATGGTCCAA
AAGTTGCAGCACGCGAAGAATGGTGTCGACATCTTCTCGGAAAGTCAG
ATAAAAACTCACTTTGCGAGGCCTAATTGGAGAAAGGTGTTCTCTGAAATTGCAATGCGGCACAAGTCGTCT
CGTATAG
GTGTTTTCTATTGTGGGAGTTCGGTGCTCACCAAAACACTGAGGAAGCTATGTCAAGAACTCAGCCTAGAGTCGTCAACTCGCTTCCAATTCCACAAGGAAAACTTTTAG

Retrieve as FASTA