Entry information : OsPrx09
Entry ID 1019
Creation 2009-01-08 (Christophe Dunand)
Last sequence changes 2011-02-15 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-16 (Qiang Li)
Peroxidase information: OsPrx09
Name OsPrx09
Class Class III peroxidase    [Orthogroup: Prx230]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx09
start..stop
S start..stop
OsPrx10 563 0 15..339 23..344
SiPrx08 356 4e-123 15..339 24..344
SbPrx58 353 8e-122 3..339 6..344
SbPrx59 350 1e-120 14..339 24..345
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..207 207 N° 2 298..483 186 N° 3 522..1109 588  
join(1..207,298..483,522..1109)


exon

Literature and cross-references OsPrx09
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q5U1T4
DNA ref. GenBank:   NC_008394.1 (10712323..10711218)
Protein sequence: OsPrx09
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   339 (328)
PWM (Da):   %s   35496.84 (34354.2)  
PI (pH):   %s   5.67 (5.35) Peptide Signal:   %s   cut: 12 range:12-339
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLAVAFRLVAAVVVPSAAPGGLTVGYYNGKCNNVNVESIVYNTVKDFLDADRSKGAALVRLLFHDCFVRGCDGSILLDNSTANPSPEKMSGANIGIAGLDVIDAIKAKLETACPGVVSCADMSCSRAATRRAGRLDGVVSSAADATNTLPDSKTGVATLISNFAKKGFTPEELVILSGAHSIGKAHSSNFDDRLTAPDSEINADYRDNVLNKTCKSSSAAANPTLANNIRDIDAATLGDLASYVVPAVGGDYLDNSYYKNNKNNLVLFHSDWALVGTNSTLQHVNEYAENGTLWNIDFAQALVKLSKLAMPAGSVGQIRKTCRAIN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, intron 1 and 2). No EST. Missing 'c'.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTGGCGGTGGCCTTCCGGCTAGTCGCCGCGGTCGTGGTGCCGTCGGCGGCGCCGGGCGGGTTGACGGTGGGTTACTACAATGGCAAGTGCAACAACGTCAACGTCGAGTCCATCGTG
TACAATACCGTGAAGGACTTCCTCGATGCTGATAGATCCAAGGGCGCCGCCCTCGTACGCTTGTTGTTCCATGACTGCTTCGTCAGG
GTAAACACAACTAATGCTCACGCAACCATGCAT
AATACAATCGTTCGTATTATTTATCAATTGTCTGATTACTATTCTTTTGGACATTAGGGCTGTGATGGATCGATCCTTCTTGATAATTCGACCGCAAATCCTTCACCGGAGAAGATGTCC
GGCGCGAACATCGGCATCGCGGGGCTCGACGTGATCGACGCGATCAAGGCCAAGCTCGAGACCGCGTGCCCCGGCGTCGTCTCCTGCGCCGACATGTCGTGTTCGCGGGCCGCGACGCGT
CGA
GGTACATGAGCAACGGCGGCGTCAGCTTCGACGTGCCAGCCGGCCGCCTCGACGGCGTCGTCTCCTCGGCCGCGGACGCCACGAATACCCTCCCCGACTCCAAGACCGGCGTCGCCA
CGCTGATCTCCAACTTCGCGAAAAAGGGGTTCACCCCGGAGGAGCTGGTCATCCTCTCCGGCGCGCACTCCATCGGCAAGGCGCACTCCTCCAACTTCGACGACCGCCTCACCGCGCCGG
ACTCCGAGATCAACGCCGACTACCGCGACAACGTCCTGAACAAGACCTGCAAGTCGTCCTCCGCCGCGGCGAACCCGACGCTGGCGAACAACATCCGCGACATCGACGCGGCGACGCTGG
GGGACCTGGCGAGCTACGTCGTCCCGGCCGTCGGCGGCGACTACCTGGACAACAGCTACTACAAGAACAACAAGAACAACCTGGTGCTGTTCCACTCCGACTGGGCGCTCGTCGGAACCA
ACTCCACGCTCCAGCACGTCAACGAGTACGCCGAGAACGGCACGCTGTGGAACATCGACTTCGCGCAGGCGCTCGTCAAGCTCAGCAAGCTGGCCATGCCGGCGGGGAGCGTCGGCCAGA
TCAGGAAGACGTGCCGCGCCATCAACTAA

Retrieve as FASTA