Entry information : NtetDyPrx01_2509
Entry ID 10193
Creation 2012-01-26 (Christophe Dunand)
Last sequence changes 2012-05-23 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-05-23 (Christophe Dunand)
Peroxidase information: NtetDyPrx01_2509
Name NtetDyPrx01_2509
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Sordariaceae Neurospora
Organism Neurospora tetrasperma    [TaxId: 40127 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value NtetDyPrx01_2509
start..stop
S start..stop
NcDyPrx 1012 0 1..513 1..513
NtetDyPrx01_2508 1011 0 1..513 1..513
SmaDyPrx 914 0 1..513 1..513
NdisDyPrx 885 0 1..513 1..518
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3846051..3846094 44 N° 2 3845748..3845985 238 N° 3 3845313..3845689 377 N° 4 3845161..3845253 93
N° 5 3844986..3845096 111 N° 6 3844834..3844931 98 N° 7 3844197..3844777 581  
complement(join(3844197..3844777,3844834..3844931,3844986..3845096,3845161..3845 253,3845313..3845689,3845748..3845985,3846051..3846094))


exon

Literature and cross-references NtetDyPrx01_2509
DNA ref. JGI genome:   scaffold_1 (3846094..3844197)
Cluster/Prediction ref. JGI gene:   153885
Protein sequence: NtetDyPrx01_2509
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   513
PWM (Da):   %s   58085.55  
PI (pH):   %s   7.82
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSWVARKANIQGDVWPGLPKRFQTFLFFKIRKPDEFKTRLRSFVDEHITTAQEACDMKNKISEVRKQAKDHGVPAKILALPGVNIAFASTGLALGKFTFNEAAVKKDRNLSKIFKKNQLRGGLFGKGMYEDLVGEGWDEPKELRSQFKPSAGKRLIDGVLMVTASRAEDLRYKVLRVKEHFLKEPGSDDPDTVRYSNDPCLEFPFTSHGRTRPEKGKEHFGFEDGISQPLIEGLDEVVPKGKEPKAVKSGLIFARHDGDDMNQPEWAEDGSFLVIRDLQQLVPEFEKWLEDNKHNAPFAADSDDPKEKLAAYLMGRWRGTPVDESPHHDKDPKLFRSNNFDFHPVDKHERCPFAAHIRKMRPRGDLDHDHAVIIRRGISYGDEVTPEEKAAQKSDDEKERGLMFVCYQSDIRNGFNFLTTRWASNHHFPDRKANFVGEHGPGIDAIVGQRLEHHPERSIGLPDGKHPTEARIGLDRWVIPRGGEYFFTPSIKALKGYLTGPPDYPPELAGP

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGTTGGGTTGCGAGGAAAGCGAATATTCAGGGTGACGTCTGGTAAGTCTCGCTAGACTGCACATTCTTTTGAGATGTCATGGTTTGCTGATTCTTCTTCCCATCAGGCCCGGCCTGC
CAAAAAGGTTCCAGACCTTCCTATTCTTCAAGATCAGGAAGCCAGATGAATTCAAGACGCGACTCCGATCTTTCGTGGATGAACATATCACCACCGCCCAGGAGGCTTGTGACATGAAGA
ACAAGATCTCGGAGGTAAGGAAACAAGCTAAGGATCATGGTGTCCCGGCCAAGATTCTGGCCTTGCCAGGCGTCAACATTGCCTTTGCCTCGACTGGTCTAGCAGCT
GTAAGTCATACCT
AGCCAAGGCGCCGTGCTAGAAAGAGTCGCTAACTGATCACATTAGCTGGGAAAATTCACCTTCAACGAGGCCGCCGTCAAGAAGGACAGAAATCTATCCAAGATCTTCAAGAAGAACCAG
CTCCGTGGTGGCTTGTTCGGGAAGGGCATGTATGAAGACCTGGTGGGTGAGGGCTGGGACGAGCCGAAAGAGCTTCGATCACAGTTCAAGCCGTCTGCGGGAAAGCGGCTGATTGATGGC
GTGCTGATGGTAACGGCGAGTCGTGCGGAAGACCTGAGATACAAAGTCCTTCGCGTCAAGGAACACTTCCTTAAGGAGCCGGGCAGTGATGATCCTGATACTGTTCGGTACAGCAATGAC
CCCTGCCTTGAGTTCCCGTTCACCAGCCATGGTCGAACTCGCCCTGAAAAGGGCAAGGAACA
GTGAGTCTGCTTTGTACAATTACCTATGATGATCAGCACGGACTGACCGAGATTTTCA
GCTTCGGCTTCGAGGACGGCATTAGCCAGCCCTTGATTGAGGGATTGGATGAAGTGGTGCCCAAGGGCAAAGAGCCAAAGGCTGTCAAGTCGGGGTAAGGTGTTCGGAAGCTTTACGGTA
TTGATTATCGGAACTGACAAAGGGTATTCGGATTGCAGATTGATCTTCGCCCGACACGATGGCGACGATATGAACCAGCCGGAATGGGCCGAGGACGGCAGTTTCCTCGTGATCCGTGAC
CTTCAACAGCTCGTCCCTGAGTTTGAGAA
GTAAGTTTTCTACGCGTCAGGAGTAGAGTCAGTACTAATTGAACACAACTTCAGGTGGCTCGAAGACAACAAACACAATGCGCCGTTCGCC
GCGGACTCCGATGACCCGAAGGAAAAGCTTGCAGCGTATCTGATGGGCAGATGGAGGAACG
GTACGTGTCAATCAATCAAGTTCCAAGCTCATGTTGCTCATGAACATTCACAATAGGAA
CCCCCGTCGACGAGAGCCCTCACCACGACAAAGACCCAAAGCTTTTCCGATCCAACAACTTTGACTTCCACCCTGTCGACAAGCACGAAAGATGCCCCTTTGCAGCTCACATCCGCAAGA
TGCGGCCCCGCGGCGACCTGGACCACGATCACGCGGTTATCATCCGCCGTGGCATCTCCTACGGAGACGAAGTGACGCCTGAAGAAAAGGCCGCACAGAAGTCTGATGACGAGAAAGAGC
GCGGCTTGATGTTCGTGTGCTACCAAAGTGACATCCGCAACGGATTCAACTTCTTGACCACCCGCTGGGCTAGCAACCACCACTTCCCGGACCGCAAGGCGAACTTTGTTGGCGAGCACG
GTCCCGGTATCGATGCTATTGTGGGCCAGAGACTTGAACACCACCCGGAGCGCTCTATCGGTCTGCCTGATGGCAAGCACCCTACTGAGGCACGCATTGGACTCGACCGCTGGGTGATCC
CACGAGGTGGTGAATACTTCTTCACGCCATCCATCAAGGCGCTGAAGGGATATCTGACTGGCCCCCCTGATTATCCGCCAGAGCTTGCCGGCCCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGTTGGGTTGCGAGGAAAGCGAATATTCAGGGTGACGTCTGGCCCGGCCTGCCAAAAAGGTTCCAGACCTTCCTATTCTTCAAGATCAGGAAGCCAGATGAATTCAAGACGCGACTC
CGATCTTTCGTGGATGAACATATCACCACCGCCCAGGAGGCTTGTGACATGAAGAACAAGATCTCGGAGGTAAGGAAACAAGCTAAGGATCATGGTGTCCCGGCCAAGATTCTGGCCTTG
CCAGGCGTCAACATTGCCTTTGCCTCGACTGGTCTAGCAGCT
CTGGGAAAATTCACCTTCAACGAGGCCGCCGTCAAGAAGGACAGAAATCTATCCAAGATCTTCAAGAAGAACCAGCTC
CGTGGTGGCTTGTTCGGGAAGGGCATGTATGAAGACCTGGTGGGTGAGGGCTGGGACGAGCCGAAAGAGCTTCGATCACAGTTCAAGCCGTCTGCGGGAAAGCGGCTGATTGATGGCGTG
CTGATGGTAACGGCGAGTCGTGCGGAAGACCTGAGATACAAAGTCCTTCGCGTCAAGGAACACTTCCTTAAGGAGCCGGGCAGTGATGATCCTGATACTGTTCGGTACAGCAATGACCCC
TGCCTTGAGTTCCCGTTCACCAGCCATGGTCGAACTCGCCCTGAAAAGGGCAAGGAACA
CTTCGGCTTCGAGGACGGCATTAGCCAGCCCTTGATTGAGGGATTGGATGAAGTGGTGCCC
AAGGGCAAAGAGCCAAAGGCTGTCAAGTCGGG
ATTGATCTTCGCCCGACACGATGGCGACGATATGAACCAGCCGGAATGGGCCGAGGACGGCAGTTTCCTCGTGATCCGTGACCTTCAA
CAGCTCGTCCCTGAGTTTGAGAA
GTGGCTCGAAGACAACAAACACAATGCGCCGTTCGCCGCGGACTCCGATGACCCGAAGGAAAAGCTTGCAGCGTATCTGATGGGCAGATGGAGGAAC
G
GAACCCCCGTCGACGAGAGCCCTCACCACGACAAAGACCCAAAGCTTTTCCGATCCAACAACTTTGACTTCCACCCTGTCGACAAGCACGAAAGATGCCCCTTTGCAGCTCACATCCGC
AAGATGCGGCCCCGCGGCGACCTGGACCACGATCACGCGGTTATCATCCGCCGTGGCATCTCCTACGGAGACGAAGTGACGCCTGAAGAAAAGGCCGCACAGAAGTCTGATGACGAGAAA
GAGCGCGGCTTGATGTTCGTGTGCTACCAAAGTGACATCCGCAACGGATTCAACTTCTTGACCACCCGCTGGGCTAGCAACCACCACTTCCCGGACCGCAAGGCGAACTTTGTTGGCGAG
CACGGTCCCGGTATCGATGCTATTGTGGGCCAGAGACTTGAACACCACCCGGAGCGCTCTATCGGTCTGCCTGATGGCAAGCACCCTACTGAGGCACGCATTGGACTCGACCGCTGGGTG
ATCCCACGAGGTGGTGAATACTTCTTCACGCCATCCATCAAGGCGCTGAAGGGATATCTGACTGGCCCCCCTGATTATCCGCCAGAGCTTGCCGGCCCTTGA

Retrieve as FASTA