Entry information : SpopDyPrx
Entry ID 10195
Creation 2012-01-27 (Christophe Dunand)
Last sequence changes 2012-01-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2013-09-04 (Catherine Mathe (Scipio))
Peroxidase information: SpopDyPrx
Name SpopDyPrx
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Mycosphaerellaceae Mycosphaerella
Organism Septoria populicola (Mycosphaerella populicola)    [TaxId: 215467 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SpopDyPrx
start..stop
S start..stop
MpopDyPrx 824 0 46..460 1..415
MpiDyPrx01 498 1e-170 48..479 2..435
BcomDyPrx 359 6e-117 47..462 3..387
MgDyPrx 315 1e-102 52..327 1..275
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 364529..364945 417 N° 2 363525..364478 954 N° 3 362869..363017 149 N° 4 362633..362649 17
N° 5 362455..362585 131 N° 6 362111..362327 217 N° 7 361960..362064 105 N° 8 361705..361907 203
complement(join(361705..361907,361960..362064,362111..362327,362455..362585,3626 33..362649,362869..363017,363525..364478,364529..364945))


exon

Literature and cross-references SpopDyPrx
DNA ref. JGI genome:   scaffold_7 (364945..361705)
Cluster/Prediction ref. JGI gene:   51868
Protein sequence: SpopDyPrx
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   731
PWM (Da):   %s   81946.1  
PI (pH):   %s   7.01
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEWRAGRDGKLERYKYVDFEQVNSDTIFTFHLPQKLRHCTCFSIIMATNITDLSNVQGDILLKGLTKEVETFWFFTIIDNTKFGHALRKVANHDISHTQHVLDTRRHIKDFKAQRGHSHTEKLPTVGANISFSFSGLQKIAAVTGLQVSTGDTIFETGMKAAAVSDLHDPVKADDPQTPDWEADWLNHQIDGVLLVAGNCKDIVHKKLHHIISQFGSSVQRALEIDGNVRPGTQKGKEHFGYQDGISQPIVGDLPNLTKDEMFVPPGQDIIPQGVILCGRPGDAKATSRPSWMLDGSFLCIRKLKQDVSAWENFVVQSSSELGISPDLLGARLVGRWKSGCPINLQPDFDNTEIARDVLRNNLFEFDPTGLNSAKEFTITAGQPSVICPFGAHIRKTNPRGDQPPDGRASANIHRILRRGIPYGPEMSEDPAAERGLLFACYQSDLSQGFELIQKRWVRDWIGIEMVGFGGLGARIYMGGGVHFSEKVHVEALAGLGQAVDRVAYNHRDPRREGTDNDACSQSACYRARRQIRRGEERTYVTVESKEYWRSVRERGWGIMMLYTNTCRAHLTVILCKLSLGRFVMSSKNSSVDSCEKFDKELSTPTTTGTSDAGFAGDLESGSEKKPIWAWPTRLMSRWHSNTARKADEPLGQPDHWSALTRSLEEIPRGYPAIAVFRSGDRNFLQFRGFNYLHCRVLSDLQHGIELLEEELDELDQHDHEINQRDCKVD*

Retrieve as FASTA  
Remarks Complete sequencefrom genomic (7 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAATGGCGAGCCGGTCGTGATGGCAAGCTTGAGAGATATAAATATGTGGATTTCGAGCAGGTGAATTCTGACACCATATTCACTTTCCATCTTCCGCAGAAACTCCGACATTGCACG
TGCTTCTCCATAATTATGGCTACCAATATCACTGATCTCAGCAATGTCCAAGGGGACATTCTCCTCAAGGGCTTGACGAAAGAGGTCGAGACCTTTTGGTTCTTTACCATTATCGACAAT
ACCAAATTCGGTCACGCTCTACGCAAGGTAGCGAATCATGACATCTCGCATACGCAACATGTCCTGGACACCCGTCGCCACATCAAGGACTTCAAAGCCCAGAGAGGCCATTCGCATACC
GAGAAGCTGCCAACCGTCGGTGCTAACATCTCATTCTCCTTCAGTGGACTCCAAAAG
GTTCGCCATATCCCGTGTGGGTCCCGTGCATCTCTGACGATAGACAACAGATCGCCGCCGTCA
CCGGTCTGCAAGTGAGCACAGGCGATACCATCTTTGAGACCGGAATGAAAGCTGCAGCTGTGTCCGATTTGCACGATCCTGTAAAAGCAGATGACCCTCAAACTCCAGACTGGGAAGCAG
ACTGGCTCAACCACCAGATCGATGGCGTATTGCTCGTTGCTGGCAACTGCAAGGATATTGTCCATAAGAAACTGCACCACATAATCTCTCAATTCGGATCTTCCGTGCAGCGTGCACTCG
AGATCGATGGTAATGTCCGTCCAGGGACACAAAAGGGCAAAGAACACTTTGGTTATCAAGACGGAATCTCGCAGCCAATCGTGGGCGACCTCCCTAACCTCACCAAGGACGAAATGTTTG
TCCCTCCCGGACAAGACATCATCCCCCAAGGCGTCATACTCTGCGGCCGACCCGGCGACGCCAAAGCCACCAGCCGACCCTCCTGGATGCTCGACGGCTCCTTCCTCTGCATCCGCAAAC
TCAAACAAGACGTGTCCGCCTGGGAAAACTTCGTCGTCCAATCCTCCTCCGAACTCGGCATCTCCCCGGACCTCCTCGGAGCCCGCCTTGTCGGCCGCTGGAAATCCGGATGTCCCATCA
ACCTCCAACCCGACTTCGACAACACCGAAATCGCGCGAGACGTCCTCCGAAACAACCTCTTCGAATTCGATCCCACGGGTTTGAACTCGGCGAAAGAGTTTACCATTACAGCCGGTCAGC
CGAGTGTCATCTGTCCCTTTGGCGCTCATATCCGGAAGACAAACCCCAGAGGCGATCAACCCCCCGATGGGCGAGCGAGTGCGAATATCCATCGGATCTTACGCCGAGGAATTCCATATG
GTCCAGAAATGAGTGAGGATCCTGCTGCGGAGCGAGGCTTGCTGTTTGCGTGTTATCAGAGTGATCTCAGTCAAGGGTTTGAGTTGATTCAGAAACGTTGG
GTGAGTGATCTCTCTCCCT
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNAAAGGAATGGAGATGAGATGAGATGAGATAGGAAAGAAATGAAAAGAAATGGAATAAAATTTACAAGATATGATTGAGTGTTCTCTCTCTCTCTCTCTCTCTCT
CAAAAAAGGTTCGGGACTGGATTGGAATTGAGATGGTAGGTTTTGGAGGGCTAGGAGCTAGGATATATATGGGAGGGGGAGTACATTTCTCTGAAAAAGTACATGTAGAGGCCCTTGCAG
GGCTCGGCCAGGCCGTGGACCGAGTAGCATACAATCA
GTAAGTTGTTTCGACATGGCCCATCGTGATCTAGTACCAGAGTATCCAGACCACGTCTGAGCTGTCGCTGGGGATCACGGTTG
CTATCCAACTTCTGGATCGTTGACTTGAACTTGAAACGCTTTTCGAAAAGATCATGCAATTCTTTGGACTAGACGTCATGAGCGTCCTTGTGTAAGTGTAAGTTGACACGGCCGATCACT
TACCTCACGTTCGCAGTCGAGATCCTCGTCGAGGTACTTCGCCCAATGCACTATCAATGCAGCGACGTTTTGATACTTAGAAGGTACCGACAACGATGCTTGCTCCCAAAGTGCCTGCTA
TCGTGCGAGACGTCAAATACGACGGGGTGAAGAGAGAACATACGTAACAGTCGAGAGTAAAGAGTACTGGCGAAGCGTACGAGAGCGGGGC
GTACGTAGCTGAGAGTAGGCTACGTTGAT
ATATTTCAGTCAATGTACGTCCGGTGGGCTGAGCGCCTAGTGATGCACCCGGAAGTGCGACTACGCCTGTGTCACGCATTATTCATTGACCATTGCAGTGGGGCATTATGATGCTGTATA
CTAATACATGTCGGGCGCATCTCACTGTCATCTTGTGCAAACTGTCCCTGGGAAGATTCGTTATGTCCAGCAAGAACTCTTCCGTAGACTCTTGCGAAAAGTTCGACAAGGAGCTGTCAA
CACCTACCACCACAGGCACCAGTGATGCAGGCTTTGCTGGAGATCTGGAGTCGGGCAGCGAGAAGAAGCCAATAT
GTTAGTCAACTCATGAACGGACGCGCAGACGTACTGATCGTTGCA
GGGGCGTGGCCAACACGGCTCATGAGTCGGTGGCATTCGAATACCGCGAGAAAAGCCGACGAGCCACTTGGACAACCTGATCACTGGTCCGCTCTGACCAGAAGTCGTGAGTGGAGCATA
CAATTTGAAGGAGAAGTGCCAAATTGACAATGCCGTAGTCGAAGAAATTCCTCGTGGATATCCCGCCATCGCAGTGTTCAGGTCGGGTGACCGAAACTTTCTCCAATTCCGAGGATTCAA
TTATTTGCATTGTCGTGTTCTTTCCGACCTCCAACACGGCATTGAGCTACTGGAAGAGGAGCTAGACGAACTTGACCAGCATGACCACGAGATCAACCAGAGAGACTGCAAAGTAGACTA
G

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAATGGCGAGCCGGTCGTGATGGCAAGCTTGAGAGATATAAATATGTGGATTTCGAGCAGGTGAATTCTGACACCATATTCACTTTCCATCTTCCGCAGAAACTCCGACATTGCACG
TGCTTCTCCATAATTATGGCTACCAATATCACTGATCTCAGCAATGTCCAAGGGGACATTCTCCTCAAGGGCTTGACGAAAGAGGTCGAGACCTTTTGGTTCTTTACCATTATCGACAAT
ACCAAATTCGGTCACGCTCTACGCAAGGTAGCGAATCATGACATCTCGCATACGCAACATGTCCTGGACACCCGTCGCCACATCAAGGACTTCAAAGCCCAGAGAGGCCATTCGCATACC
GAGAAGCTGCCAACCGTCGGTGCTAACATCTCATTCTCCTTCAGTGGACTCCAAAAG
ATCGCCGCCGTCACCGGTCTGCAAGTGAGCACAGGCGATACCATCTTTGAGACCGGAATGAAA
GCTGCAGCTGTGTCCGATTTGCACGATCCTGTAAAAGCAGATGACCCTCAAACTCCAGACTGGGAAGCAGACTGGCTCAACCACCAGATCGATGGCGTATTGCTCGTTGCTGGCAACTGC
AAGGATATTGTCCATAAGAAACTGCACCACATAATCTCTCAATTCGGATCTTCCGTGCAGCGTGCACTCGAGATCGATGGTAATGTCCGTCCAGGGACACAAAAGGGCAAAGAACACTTT
GGTTATCAAGACGGAATCTCGCAGCCAATCGTGGGCGACCTCCCTAACCTCACCAAGGACGAAATGTTTGTCCCTCCCGGACAAGACATCATCCCCCAAGGCGTCATACTCTGCGGCCGA
CCCGGCGACGCCAAAGCCACCAGCCGACCCTCCTGGATGCTCGACGGCTCCTTCCTCTGCATCCGCAAACTCAAACAAGACGTGTCCGCCTGGGAAAACTTCGTCGTCCAATCCTCCTCC
GAACTCGGCATCTCCCCGGACCTCCTCGGAGCCCGCCTTGTCGGCCGCTGGAAATCCGGATGTCCCATCAACCTCCAACCCGACTTCGACAACACCGAAATCGCGCGAGACGTCCTCCGA
AACAACCTCTTCGAATTCGATCCCACGGGTTTGAACTCGGCGAAAGAGTTTACCATTACAGCCGGTCAGCCGAGTGTCATCTGTCCCTTTGGCGCTCATATCCGGAAGACAAACCCCAGA
GGCGATCAACCCCCCGATGGGCGAGCGAGTGCGAATATCCATCGGATCTTACGCCGAGGAATTCCATATGGTCCAGAAATGAGTGAGGATCCTGCTGCGGAGCGAGGCTTGCTGTTTGCG
TGTTATCAGAGTGATCTCAGTCAAGGGTTTGAGTTGATTCAGAAACGTTGG
GTTCGGGACTGGATTGGAATTGAGATGGTAGGTTTTGGAGGGCTAGGAGCTAGGATATATATGGGAGGG
GGAGTACATTTCTCTGAAAAAGTACATGTAGAGGCCCTTGCAGGGCTCGGCCAGGCCGTGGACCGAGTAGCATACAATCA
TCGAGATCCTCGTCGAGAAGGTACCGACAACGATGCTTGC
TCCCAAAGTGCCTGCTATCGTGCGAGACGTCAAATACGACGGGGTGAAGAGAGAACATACGTAACAGTCGAGAGTAAAGAGTACTGGCGAAGCGTACGAGAGCGGGGC
TGGGGCATTATG
ATGCTGTATACTAATACATGTCGGGCGCATCTCACTGTCATCTTGTGCAAACTGTCCCTGGGAAGATTCGTTATGTCCAGCAAGAACTCTTCCGTAGACTCTTGCGAAAAGTTCGACAAG
GAGCTGTCAACACCTACCACCACAGGCACCAGTGATGCAGGCTTTGCTGGAGATCTGGAGTCGGGCAGCGAGAAGAAGCCAATAT
GGGCGTGGCCAACACGGCTCATGAGTCGGTGGCAT
TCGAATACCGCGAGAAAAGCCGACGAGCCACTTGGACAACCTGATCACTGGTCCGCTCTGACCAGAAGTC
TCGAAGAAATTCCTCGTGGATATCCCGCCATCGCAGTGTTCAGGTCGGGT
GACCGAAACTTTCTCCAATTCCGAGGATTCAATTATTTGCATTGTCGTGTTCTTTCCGACCTCCAACACGGCATTGAGCTACTGGAAGAGGAGCTAGACGAACTTGACCAGCATGACCAC
GAGATCAACCAGAGAGACTGCAAAGTAGACTAG

Retrieve as FASTA