Entry information : CgrayDyPrx01
Entry ID 10196
Creation 2012-01-27 (Christophe Dunand)
Last sequence changes 2012-01-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: CgrayDyPrx01
Name CgrayDyPrx01
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Ascomycota Lecanoromycetes Cladoniaceae Cladonia
Organism Cladonia grayi    [TaxId: 27339 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CgrayDyPrx01
start..stop
S start..stop
CsuDyPrx01 498 1e-172 1..403 1..376
CsuDyPrx01 252 2e-77 412..597 294..481
HanDyPrx01 428 3e-145 1..412 1..387
HanDyPrx01 234 2e-70 412..597 298..483
ShirDyPrx02 427 4e-145 1..411 1..390
ShirDyPrx02 218 4e-64 412..597 301..487
TvDyPrx01_other 423 2e-143 7..409 6..386
TvDyPrx01_other 243 8e-74 396..597 283..485
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 289041..289096 56 N° 2 288750..288990 241 N° 3 288364..288716 353 N° 4 287992..288305 314
N° 5 287654..287923 270 N° 6 287063..287398 336 N° 7 286955..287013 59 N° 8 286621..286803 183
complement(join(286621..286803,286955..287013,287063..287398,287654..287923,2879 92..288305,288364..288716,288750..288990,289041..289096))


exon

Literature and cross-references CgrayDyPrx01
DNA ref. JGI genome:   scaffold_35 (289096..286621)
Cluster/Prediction ref. JGI gene:   121732
Protein sequence: CgrayDyPrx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   603
PWM (Da):   %s   66172.73  
PI (pH):   %s   6.52
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSSGPPPLDFNNIQGDILAGGLPKKTETFYFFQIDPAYVHEFRTHLTQLLPLITTSAQVVEELRPKIAQTKKNAAEEGTAPPIVEMAGVNIAFSHKGLRLETQYVTDSDVPPLQMGINDKIGDSAFDAGMLAGAKDLGDQGTKSSSGAFSPNWIPAFKHDIHGVILIAGDSHKTVDAKLAQIENIFRVGAHHALIHEVYRTVGDVRPGKEKGHEHFGFLDGISNPAVQDVDTKPFPGQETIPQGIILLGREGDDTLTNPPKPVTRPPWALDGSFLSFRYLFQLVPEFNSFLKHNPIPEVLPRELGSELLGARMVGRWKGAPIDIVPTHDDPALGADPNRNNDFRFAFPDDQKTQDRCPFAAHIRKTNPRADLEDLNPHATTPRRIMRQGIAFGREVTEAEKIFDKTLHGAPIDIVPTHDDPALGADPNRNNDFRFAFPDDQKTQDRCPFAAHIRKTNPRADLEDLNPHATTPRRIMRQGIAFGREVTEAEKIFDKTLHGRGLLFAAYQSSLVNGFQFLQQSWANKTDFPPGKGTPGFDPIGQAPDGGPRSMSGTDPKSQGTGLRLPREWVVPKGGEYFFTPSVPALKETFALAESKSEL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (7 introns). Predicted protein is longer than other orthologs (
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGTCTTCCGGTCCTCCTCCGTTGGACTTTAACAATATTCAAGGCGATATCCTGTAGGGCTATATCATGCTGTCTGGAAATTACGTGAACTTATACTTGACAGGGCAGGAGGTCTTC
CCAAGAAGACCGAGACATTCTACTTCTTCCAAATTGATCCTGCCTATGTCCATGAATTTCGGACGCATCTTACTCAGCTCTTGCCCTTGATCACAACAAGTGCCCAGGTCGTAGAGGAGC
TGAGGCCAAAGATCGCACAAACCAAGAAAAATGCGGCGGAAGAGGGTACCGCTCCGCCGATCGTGGAAATGGCTGGAGTCAACATAGCCTTTAGCCACAAAGGATTG
GTCCTAGTAAGTT
ACCTGCTATCATTTGATTAGCTCAGACTTGAAACCCAATATGTCACTGACTCGGACGTTCCACCCTTGCAGATGGGAATTAATGACAAGATCGGAGACTCTGCTTTCGATGCTGGCATGC
TGGCTGGTGCAAAAGATCTTGGAGACCAAGGAACGAAGTCGTCCTCGGGTGCATTCAGTCCTAACTGGATTCCTGCTTTCAAGCATGACATTCACGGGGTGATATTGATTGCTGGAGACA
GCCATAAAACTGTCGATGCGAAACTAGCGCAGATCGAGAATATCTTCCGGGTTGGAGCGCATCATGCTCTCATTCATGAAGTATACCGTACGGTCGGTGATGTCCGCCCTGGAAAGGAGA
AAGGTCATGAGCA
GTTCGTACCCGTCCTTTCTGTTTCGTGGATATCTTAACACCGCTGATGGCTGATCTAGCTTCGGCTTCCTCGACGGTATTTCCAATCCAGCAGTCCAGGATGTCGAC
ACCAAACCCTTTCCTGGTCAAGAGACAATACCTCAGGGTATCATCCTCCTCGGCCGTGAGGGTGATGACACACTAACAAATCCACCAAAACCTGTTACTCGGCCACCTTGGGCTTTAGAT
GGGAGTTTCCTTTCTTTTCGCTATCTCTTTCAGCTGGTCCCTGAATTCAATTCATTCCTGAAACATAATCCTATTCCGGAGGTGCTCCCTAGGGAATTAGGCAGTGAGCTGCTTGGGGCC
CGCATGGTAGGACGGTGGAAGAGTG
GTATGTCGTTTTTACTTCTCATCTGTTGCAATTGTGATTGTTGCACTGGTTCTCATGGTAATCGCTAGGAGCGCCGATTGATATTGTCCCAACGC
ACGACGACCCAGCACTTGGGGCGGACCCGAATCGAAACAACGACTTCCGATTCGCATTCCCCGACGACCAGAAGACTCAAGATAGATGCCCTTTCGCAGCGCATATCCGTAAGACTAACC
CTAGAGCTGACCTCGAAGACCTCAATCCGCACGCCACCACACCGCGTCGCATTATGCGGCAAGGTATTGCATTTGGGCGTGAAGTTACCGAGGCCGAAAAGATCTTTGATAAGACACTCC
ATG
GTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGCTTGGGGCCCGCATGGTAGGACGGTGGAAGAGTGGTATGTCGTTTTACTTCTCATCTGTTGCAATTGTGATTGTTGCACTGGT
TCTCATGGTAATCGCTAGGAGCGCCGATTGATATTGTCCCAACGCACGACGACCCAGCACTTGGGGCGGACCCGAATCGAAACAACGACTTCCGATTCGCGTTCCCCGACGACCAGAAGA
CTCAAGATAGATGCCCTTTCGCAGCGCATATCCGTAAGACTAACCCCAGAGCTGACCTCGAAGACCTCAATCCGCACGCCACCACACCGCGTCGCATTATGCGGCAAGGTATTGCATTCG
GGCGTGAAGTTACCGAGGCCGAAAAGATCTTTGATAAGACACTCCATGGCCGCGGACTTCTCTTTGCAGCGTACCAAAGTAGTCTCGTGAATGGGTTCCAATTCTTACAGCAAT
GTAGGT
CATCTCCGCACCACTTTGATGACTGCTTACTGATCGTCTTTAGCTTGGGCGAATAAGACTGATTTCCCACCTGGTAAGGGAACGCCAGGGTTTGACCCGATTGTAAGTCTATTTGCGAGC
TATTATGCGTCGTCACTTGCTTGATTAACCGCCGAGACATGGCTGGAAAATCAAAGTCTCTTTCCAACTGCCAAGGCTCCTGGTCTAATCCAAGAGACATCGAGCAAGCACAAGCTAATA
TCAGTATCTCTAGATTGGTCAGGCCCCTGACGGAGGACCGCGTTCGATGTCGGGCACGGATCCTAAGAGTCAGGGTACCGGGCTTCGTTTGCCACGGGAGTGGGTCGTGCCGAAAGGCGG
CGAATATTTCTTCACACCTTCTGTTCCTGCCCTCAAAGAGACTTTCGCATTGGCAGAATCGAAGTCTGAGCTATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGTCTTCCGGTCCTCCTCCGTTGGACTTTAACAATATTCAAGGCGATATCCTGGCAGGAGGTCTTCCCAAGAAGACCGAGACATTCTACTTCTTCCAAATTGATCCTGCCTATGTC
CATGAATTTCGGACGCATCTTACTCAGCTCTTGCCCTTGATCACAACAAGTGCCCAGGTCGTAGAGGAGCTGAGGCCAAAGATCGCACAAACCAAGAAAAATGCGGCGGAAGAGGGTACC
GCTCCGCCGATCGTGGAAATGGCTGGAGTCAACATAGCCTTTAGCCACAAAGGATTG
CTCAGACTTGAAACCCAATATGTCACTGACTCGGACGTTCCACCCTTGCAGATGGGAATTAAT
GACAAGATCGGAGACTCTGCTTTCGATGCTGGCATGCTGGCTGGTGCAAAAGATCTTGGAGACCAAGGAACGAAGTCGTCCTCGGGTGCATTCAGTCCTAACTGGATTCCTGCTTTCAAG
CATGACATTCACGGGGTGATATTGATTGCTGGAGACAGCCATAAAACTGTCGATGCGAAACTAGCGCAGATCGAGAATATCTTCCGGGTTGGAGCGCATCATGCTCTCATTCATGAAGTA
TACCGTACGGTCGGTGATGTCCGCCCTGGAAAGGAGAAAGGTCATGAGCA
CTTCGGCTTCCTCGACGGTATTTCCAATCCAGCAGTCCAGGATGTCGACACCAAACCCTTTCCTGGTCAA
GAGACAATACCTCAGGGTATCATCCTCCTCGGCCGTGAGGGTGATGACACACTAACAAATCCACCAAAACCTGTTACTCGGCCACCTTGGGCTTTAGATGGGAGTTTCCTTTCTTTTCGC
TATCTCTTTCAGCTGGTCCCTGAATTCAATTCATTCCTGAAACATAATCCTATTCCGGAGGTGCTCCCTAGGGAATTAGGCAGTGAGCTGCTTGGGGCCCGCATGGTAGGACGGTGGAAG
AGTG
GAGCGCCGATTGATATTGTCCCAACGCACGACGACCCAGCACTTGGGGCGGACCCGAATCGAAACAACGACTTCCGATTCGCATTCCCCGACGACCAGAAGACTCAAGATAGATGC
CCTTTCGCAGCGCATATCCGTAAGACTAACCCTAGAGCTGACCTCGAAGACCTCAATCCGCACGCCACCACACCGCGTCGCATTATGCGGCAAGGTATTGCATTTGGGCGTGAAGTTACC
GAGGCCGAAAAGATCTTTGATAAGACACTCCATG
GAGCGCCGATTGATATTGTCCCAACGCACGACGACCCAGCACTTGGGGCGGACCCGAATCGAAACAACGACTTCCGATTCGCGTTC
CCCGACGACCAGAAGACTCAAGATAGATGCCCTTTCGCAGCGCATATCCGTAAGACTAACCCCAGAGCTGACCTCGAAGACCTCAATCCGCACGCCACCACACCGCGTCGCATTATGCGG
CAAGGTATTGCATTCGGGCGTGAAGTTACCGAGGCCGAAAAGATCTTTGATAAGACACTCCATGGCCGCGGACTTCTCTTTGCAGCGTACCAAAGTAGTCTCGTGAATGGGTTCCAATTC
TTACAGCAAT
CTTGGGCGAATAAGACTGATTTCCCACCTGGTAAGGGAACGCCAGGGTTTGACCCGATTATTGGTCAGGCCCCTGACGGAGGACCGCGTTCGATGTCGGGCACGGATCCT
AAGAGTCAGGGTACCGGGCTTCGTTTGCCACGGGAGTGGGTCGTGCCGAAAGGCGGCGAATATTTCTTCACACCTTCTGTTCCTGCCCTCAAAGAGACTTTCGCATTGGCAGAATCGAAG
TCTGAGCTATGA

Retrieve as FASTA