Entry information : GluxDyPrx01
Entry ID 10198
Creation 2012-01-27 (Christophe Dunand)
Last sequence changes 2012-01-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-03 (Catherine Mathe (Scipio))
Peroxidase information: GluxDyPrx01
Name GluxDyPrx01
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Tricholomataceae Gymnopus
Organism Gymnopus luxurians    [TaxId: 206324 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GluxDyPrx01
start..stop
S start..stop
GluxDyPrx05 738 0 1..508 1..502
GluxDyPrx07 666 0 1..507 1..499
GluxDyPrx08 660 0 1..508 1..509
GluxDyPrx03 650 0 1..507 1..515
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 484742..484859 118 N° 2 484586..484682 97 N° 3 484081..484532 452 N° 4 483737..484026 290
N° 5 483436..483667 232 N° 6 483307..483375 69 N° 7 483182..483248 67 N° 8 483072..483099 28
N° 9 482798..482894 97 N° 10 482668..482744 77  
complement(join(482668..482744,482798..482894,483072..483099,483182..483248,4833 07..483375,483436..483667,483737..484026,484081..484532,484586..484682,484742..4 84859))


exon

Literature and cross-references GluxDyPrx01
DNA ref. JGI genome:   scaffold_24 (484859..482668)
Cluster/Prediction ref. JGI gene:   166740
Protein sequence: GluxDyPrx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   509 (489)
PWM (Da):   %s   55275.09 (53280.0)  
PI (pH):   %s   6.14 (5.97) Peptide Signal:   %s   cut: 20 range:20-508
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKLALTPLLAALTCQAVSAFPNLEPSALRPRASNPSILIDPPGFPPLPSAQQAAFQSAVVGLNLSNIQGDILIGMRKKKELFFFFSIDNPTAFKSRLGSDILPLITRTTQILPNATHPPATAVNIAFSQRGLNVLGIRDDLNDTNFKNGQMYNVTATLGDQTSYWEPAFAGHHIHGVFLVASDTIDKVKATLSRIQKISKGSISEVYRIQGHARPGNEQGHHFGFLDGVSNPAVSGFAVAVPGQATVDPGIILLGESGDTGTRPDWAKDGSFLAFRQLQQRVPEFNKFLVDNALSEPGLNASENAELLGARMVGRWKGAPIDLTPLKDDPVLAVDHNRNNDFNFTHPDDPNFDFKTNQSYCPFSAHIRKTNPRADIANPFNQHIIRAGIPYGPEVTDAENASNSSSTDPSLERGLAFVSYQSNIGQGFAFLQQVWANNKNEYLYFALRIGEDPIIGVALDGERFASGLDPKNQTRNITFNDFVVSRGGEYFFSPSISAIQNTLSV

Retrieve as FASTA  
Remarks Complete sequence from genomic (9 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAACTCGCACTTACCCCTCTGCTTGCTGCCTTGACGTGCCAGGCAGTGTCCGCCTTTCCAAACCTGGAACCTTCTGCCTTGAGACCGCGAGCAAGTAACCCTTCTATTCTTATCGGT
AAGGTCATGATGAGCTGCTCAATCTGTACTCTGCTCTTACCGTGCATGCTTCGTTAGATCCCCCTGGTTTTCCGCCTCTGCCTTCCGCACAGCAAGCAGCTTTTCAGTCTGCTGTTGTCG
GGCTCAATCTTAGCAACATCCAGGGCGACATTCT
GTACGTCTTTTTTTTGATTCTTTTGCTTACATTTTATTGACTTAAATTCAAAGAATTGGTATGAGGAAGAAGAAAGAACTATTCTT
CTTCTTCAGCATCGATAACCCTACGGCATTCAAGTCTCGGCTTGGCTCAGACATCCTTCCTCTGATTACCCGAACCACTCAAATCCTTCCAAATGCTACCCATCCGCCTGCCACCGCTGT
CAACATTGCCTTTTCTCAAAGAGGTTTGAATGTGCTAGGAATCCGCGACGACCTGAATGATACAAATTTCAAGAATGGACAAATGTACAATGTTACTGCAACTCTCGGAGATCAAACGAG
CTATTGGGAGCCCGCTTTCGCTGGTCACCACATTCATGGCGTCTTTTTGGTGGCGTCGGACACCATAGACAAAGTGAAAGCCACACTATCGCGGATTCAGAAAATTTCAAAGGGTTCCAT
CTCTGAAGTCTATAGGATCCAGGGTCACGCCAGGCCTGGAAATGAACAGGGACATGAGC
GTAAGTGGTCTTTTCTCTTTCCTTCGAAATCAAACTAAAGTCTATCCTCTGTAGATTTTGG
TTTCTTGGATGGAGTAAGCAACCCCGCTGTCAGTGGTTTCGCTGTGGCCGTCCCAGGTCAGGCGACCGTAGATCCTGGTATCATCCTTCTTGGCGAATCGGGAGATACAGGAACACGTCC
AGATTGGGCCAAAGATGGCTCATTCCTTGCCTTCCGTCAACTTCAGCAACGCGTCCCAGAGTTTAACAAGTTCTTAGTTGACAATGCTCTTTCTGAACCCGGTCTCAATGCGAGTGAGAA
TGCCGAGCTTCTCGGTGCTCGCATGGTGGGACGGTGGAAAAGT
GTAAGTGCCACGAAGCACCAATGTCGTTCAATATATGTATATAAATATCGCTGATCAAACTTTTTACAGGGTGCTCC
TATTGACCTCACACCTCTTAAGGACGATCCTGTCCTCGCAGTGGATCATAACCGGAACAACGATTTCAACTTTACGCATCCTGATGATCCCAACTTCGACTTTAAAACAAACCAGTCCTA
CTGCCCCTTCTCCGCACACATTCGCAAGACAAATCCTCGTGCAGACATCGCGAATCCGTTCAATCAACATATCATTCGTGCGGGGATACCTTATGGACCTGAAG
GTATCTAATATCTTCC
ATTAGGATACGTTGATGCTCAGAGAGATGACACAACGTGTTTAGTTACTGACGCCGAAAATGCTTCCAATTCCTCCAGCACTGATCCTAGCCTCGAGCGAGGTCTAGCTTTTGGTAAGAG
GATAGGCTGATCGATCAAATGTTGCATATAGTAATAACCGAGCGATTGCAGTTTCATATCAATCAAACATTGGGCAAGGATTTGCATTCCTTCAGCAGGTTTGGGCAAACAACAAGAAGT
GAGTGGCATTGTATAATCTAGGAGCACAGTGTATTGTCGATGTGCTTGCTAAATTTTACTTCCTTCAGCTTCCATACAAGTGAGTACTTGTATTTTGCTCTGCGTATAGTTACCTCCAAT
TGATTGATTTTACTAAAACACAGGCAAGTAAGTGCATGACAATTTTGCATATATAGCTTTTCTCCTTTCTGATGCATCCAACCAACAATTCGTTGCAAATACAACAGTGTTGTAAGTTTA
TGTTCTCCACGTATGATTGCATGTCCTTGATGTCGTAAAATATAGGGCGAAGACCCAATTATTGGAGTTGCACTAGATGGCGAACGGTTTGCTTCTGGGCTTGATCCCAAGAATCAAACA
AGAAATATTACATTCAATGAAG
GTTAGCGATCTCAAATAAATAATCTACAGATTTTAGCTCATATAGCTGTTCAGATTTTGTTGTTTCACGCGGAGGGGAATATTTCTTTTCACCCTCAA
TCTCTGCAATTCAGAATACACTTTCGGTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAACTCGCACTTACCCCTCTGCTTGCTGCCTTGACGTGCCAGGCAGTGTCCGCCTTTCCAAACCTGGAACCTTCTGCCTTGAGACCGCGAGCAAGTAACCCTTCTATTCTTATCGAT
CCCCCTGGTTTTCCGCCTCTGCCTTCCGCACAGCAAGCAGCTTTTCAGTCTGCTGTTGTCGGGCTCAATCTTAGCAACATCCAGGGCGACATTCT
AATTGGTATGAGGAAGAAGAAAGAA
CTATTCTTCTTCTTCAGCATCGATAACCCTACGGCATTCAAGTCTCGGCTTGGCTCAGACATCCTTCCTCTGATTACCCGAACCACTCAAATCCTTCCAAATGCTACCCATCCGCCTGCC
ACCGCTGTCAACATTGCCTTTTCTCAAAGAGGTTTGAATGTGCTAGGAATCCGCGACGACCTGAATGATACAAATTTCAAGAATGGACAAATGTACAATGTTACTGCAACTCTCGGAGAT
CAAACGAGCTATTGGGAGCCCGCTTTCGCTGGTCACCACATTCATGGCGTCTTTTTGGTGGCGTCGGACACCATAGACAAAGTGAAAGCCACACTATCGCGGATTCAGAAAATTTCAAAG
GGTTCCATCTCTGAAGTCTATAGGATCCAGGGTCACGCCAGGCCTGGAAATGAACAGGGACATGAGC
ATTTTGGTTTCTTGGATGGAGTAAGCAACCCCGCTGTCAGTGGTTTCGCTGTG
GCCGTCCCAGGTCAGGCGACCGTAGATCCTGGTATCATCCTTCTTGGCGAATCGGGAGATACAGGAACACGTCCAGATTGGGCCAAAGATGGCTCATTCCTTGCCTTCCGTCAACTTCAG
CAACGCGTCCCAGAGTTTAACAAGTTCTTAGTTGACAATGCTCTTTCTGAACCCGGTCTCAATGCGAGTGAGAATGCCGAGCTTCTCGGTGCTCGCATGGTGGGACGGTGGAAAAGT
GGT
GCTCCTATTGACCTCACACCTCTTAAGGACGATCCTGTCCTCGCAGTGGATCATAACCGGAACAACGATTTCAACTTTACGCATCCTGATGATCCCAACTTCGACTTTAAAACAAACCAG
TCCTACTGCCCCTTCTCCGCACACATTCGCAAGACAAATCCTCGTGCAGACATCGCGAATCCGTTCAATCAACATATCATTCGTGCGGGGATACCTTATGGACCTGAAG
TTACTGACGCC
GAAAATGCTTCCAATTCCTCCAGCACTGATCCTAGCCTCGAGCGAGGTCTAGCTTTTG
TTTCATATCAATCAAACATTGGGCAAGGATTTGCATTCCTTCAGCAGGTTTGGGCAAACAAC
AAGAA
TGAGTACTTGTATTTTGCTCTGCGTATAGGCGAAGACCCAATTATTGGAGTTGCACTAGATGGCGAACGGTTTGCTTCTGGGCTTGATCCCAAGAATCAAACAAGAAATATTACA
TTCAATGAAG
ATTTTGTTGTTTCACGCGGAGGGGAATATTTCTTTTCACCCTCAATCTCTGCAATTCAGAATACACTTTCGGTCTAA

Retrieve as FASTA