Entry information : GluxDyPrx02
Entry ID 10200
Creation 2012-01-27 (Christophe Dunand)
Last sequence changes 2012-01-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-03 (Catherine Mathe (Scipio))
Peroxidase information: GluxDyPrx02
Name GluxDyPrx02
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Tricholomataceae Gymnopus
Organism Gymnopus luxurians    [TaxId: 206324 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GluxDyPrx02
start..stop
S start..stop
GluxDyPrx11 976 0 1..570 1..536
GluxDyPrx12 724 0 17..569 8..563
PgigDyPrx03 565 0 44..569 51..603
SlutDyPrx01 552 0 19..567 17..580
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 165610..165789 180 N° 2 165155..165554 400 N° 3 164947..165103 157 N° 4 164605..164899 295
N° 5 164306..164554 249 N° 6 164113..164257 145 N° 7 163778..164064 287  
complement(join(163778..164064,164113..164257,164306..164554,164605..164899,1649 47..165103,165155..165554,165610..165789))


exon

Literature and cross-references GluxDyPrx02
DNA ref. JGI genome:   scaffold_95 (165789..163778)
Cluster/Prediction ref. JGI gene:   233483
Protein sequence: GluxDyPrx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   571
PWM (Da):   %s   62680.52  
PI (pH):   %s   5.18
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSISYILDPHDPEIIPPRRSIIPSIHPDSTPGKILFGGISREPLPDLKDVQGDIVYLFPKRAENFIFFRIADVPSFKKALAKFKPSSAHDTATFIFEIAKHKKSVQAGGKVPIIKKASYQIAFSRMGMDYLGVRDETGDVRFDHRAMRDDKDMLGDQMQWDPEFNKKDFDPVHGSANKDDGTALHGVITVAAGDDETCDEYTKETIALFGESIKVVIVLEGRARPGDNAGHEHFGYKDGISQPALRNLTSERPGQIQVNCGVVIIGFKGDPVIDGAGQRPAWTKGGTMMVFRKLQQYVQLFNAYLEKNGPRWKDFVPAVPQSEALTDKQGEELWGARMIGRWKSGAPIALCPYKDNPEVAANPDMNNNFDYTIDGVNGLTDLYCPFSAHTRKTVPRNIDPYVQRAFLESSMMVRAGLPYGPEVQVMLPGEDPNEDLRGLLFISYQSSLDQGFVRQTVSFANNDYFPITSLVPTHTGQDPIIGGPPAANTPAAVATVEYDKPPEIEPKTGDLVNLATTSEGNIIEVSGFAKVRSASAVDPPGVPQEFFVTSRGGEYFFVPPISTVTEWASS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (7 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCATCTCTTACATTCTTGATCCACACGATCCGGAGATCATTCCTCCACGCCGGTCGATTATCCCTTCTATCCATCCTGACTCTACTCCAGGAAAAATCCTCTTCGGCGGAATCTCA
CGCGAGCCACTTCCAGACCTCAAAGATGTCCAAGGTGATATTGTCTACCTCTTCCCCAAG
GTATGAGATGCTGCTCCATCCTGGTGTTCAATCTCCAAAAGATGTATACCTACAGCGGGC
CGAGAACTTTATTTTTTTTCGTATTGCCGATGTGCCCTCATTCAAAAAAGCTCTTGCGAAATTCAAGCCATCGAGCGCCCATGATACTGCCACTTTCATCTTCGAGATTGCCAAACATAA
GAAAAGTGTTCAAGCTGGTGGAAAGGTTCCCATCATCAAGAAGGCCAGTTATCAAATCGCATTCAGTCGCATGGGTATGGATTATCTAGGTGTTCGCGATGAAACCGGCGATGTACGTTT
TGACCATCGGGCAATGCGAGACGACAAGGACATGCTTGGTGACCAGATGCAATGGGATCCTGAGTTTAACAAAAAAGATTTCGATCCTGTCCATGGCTCGGCGAACAAAGATGACGGAAC
AGCCCTTCATGGTGTCATTACTGTCGCTGCAGGCG
GTGAGCTTCGGGGAAGATGCTTTCTTCGCTGAGGATTGACATATTGTGCAGATGACGAGACATGCGATGAATATACAAAGGAGAC
TATAGCATTGTTCGGCGAATCCATCAAAGTTGTTATTGTGCTCGAAGGGAGGGCACGACCTGGTGATAACGCAGGACACGAGCATTTTGGCTACAAAGACGGCATCTCTCAGCCTGCCCT
TCG
GTAAATGCCATGTTGAACCTCAGATCTTGTTTTGATATTGTTATTAGCAATCTTACCTCAGAAAGGCCGGGTCAGATCCAAGTTAACTGTGGCGTAGTGATTATCGGGTTTAAGGGA
GATCCAGTTATTGATGGCGCAGGCCAACGTCCCGCTTGGACAAAAGGCGGGACCATGATGGTGTTCCGCAAGCTTCAGCAATACGTTCAATTGTTCAATGCTTACTTGGAGAAGAATGGC
CCGCGCTGGAAGGATTTTGTCCCGGCAGTCCCTCAAAGTGAGGCATTGACAGACAAGCAGGGTGAGGAGCTTTGGGGAGCTAGGATGATTGGTCGTTGGAAATCT
GTAGGCCACAATCTT
TGCATACGTGTTTCCCATTTCTAACCCTTCTGAAGGGGGCTCCTATAGCATTGTGTCCGTACAAAGATAATCCCGAGGTGGCGGCAAATCCAGACATGAACAATAATTTTGACTACACTA
TTGACGGTGTCAATGGTCTCACCGACCTATACTGCCCTTTCTCCGCTCATACACGAAAGACAGTTCCTCGAAATATAGACCCGTACGTTCAGCGGGCATTCCTTGAGTCGAGTATGATGG
TACGTGCTGGTCTGCCTTATGGTCCCGAGGTCCAGGTAATGCTA
GTCGACTCCTTATTCTAGTTGAAATGTAATTGATAGAAGCACCTGTAGCCTGGCGAAGATCCGAATGAAGACCTGC
GTGGCCTTTTATTTATATCTTATCAGTCTAGCTTGGACCAGGGCTTTGTTCGACAAACGGTGTCGTTCGCGAATAATGACTACTTCCCCATCACATCATTAGTCCCCACGCACACTG
GTA
CGTTGTTTGTCTCCCAAAATTTTACATTTGGCTCATACTTCGCAGGGCAAGATCCTATTATTGGTGGACCTCCAGCCGCGAACACACCTGCGGCTGTCGCTACGGTGGAGTACGACAAAC
CTCCTGAAATAGAACCCAAGACGGGAGACCTAGTCAACCTTGCGACTACCAGTGAAGGAAACATCATTGAAGTATCTGGCTTTGCCAAAGTCAGATCAGCCAGTGCAGTGGATCCACCTG
GCGTTCCGCAAGAGTTCTTTGTTACTTCGCGCGGCGGTGAATACTTCTTCGTACCCCCCATCTCAACAGTCACAGAATGGGCTTCCTCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCATCTCTTACATTCTTGATCCACACGATCCGGAGATCATTCCTCCACGCCGGTCGATTATCCCTTCTATCCATCCTGACTCTACTCCAGGAAAAATCCTCTTCGGCGGAATCTCA
CGCGAGCCACTTCCAGACCTCAAAGATGTCCAAGGTGATATTGTCTACCTCTTCCCCAAG
CGGGCCGAGAACTTTATTTTTTTTCGTATTGCCGATGTGCCCTCATTCAAAAAAGCTCTT
GCGAAATTCAAGCCATCGAGCGCCCATGATACTGCCACTTTCATCTTCGAGATTGCCAAACATAAGAAAAGTGTTCAAGCTGGTGGAAAGGTTCCCATCATCAAGAAGGCCAGTTATCAA
ATCGCATTCAGTCGCATGGGTATGGATTATCTAGGTGTTCGCGATGAAACCGGCGATGTACGTTTTGACCATCGGGCAATGCGAGACGACAAGGACATGCTTGGTGACCAGATGCAATGG
GATCCTGAGTTTAACAAAAAAGATTTCGATCCTGTCCATGGCTCGGCGAACAAAGATGACGGAACAGCCCTTCATGGTGTCATTACTGTCGCTGCAGGCG
ATGACGAGACATGCGATGAA
TATACAAAGGAGACTATAGCATTGTTCGGCGAATCCATCAAAGTTGTTATTGTGCTCGAAGGGAGGGCACGACCTGGTGATAACGCAGGACACGAGCATTTTGGCTACAAAGACGGCATC
TCTCAGCCTGCCCTTCG
CAATCTTACCTCAGAAAGGCCGGGTCAGATCCAAGTTAACTGTGGCGTAGTGATTATCGGGTTTAAGGGAGATCCAGTTATTGATGGCGCAGGCCAACGTCCC
GCTTGGACAAAAGGCGGGACCATGATGGTGTTCCGCAAGCTTCAGCAATACGTTCAATTGTTCAATGCTTACTTGGAGAAGAATGGCCCGCGCTGGAAGGATTTTGTCCCGGCAGTCCCT
CAAAGTGAGGCATTGACAGACAAGCAGGGTGAGGAGCTTTGGGGAGCTAGGATGATTGGTCGTTGGAAATCT
GGGGCTCCTATAGCATTGTGTCCGTACAAAGATAATCCCGAGGTGGCG
GCAAATCCAGACATGAACAATAATTTTGACTACACTATTGACGGTGTCAATGGTCTCACCGACCTATACTGCCCTTTCTCCGCTCATACACGAAAGACAGTTCCTCGAAATATAGACCCG
TACGTTCAGCGGGCATTCCTTGAGTCGAGTATGATGGTACGTGCTGGTCTGCCTTATGGTCCCGAGGTCCAGGTAATGCTA
CCTGGCGAAGATCCGAATGAAGACCTGCGTGGCCTTTTA
TTTATATCTTATCAGTCTAGCTTGGACCAGGGCTTTGTTCGACAAACGGTGTCGTTCGCGAATAATGACTACTTCCCCATCACATCATTAGTCCCCACGCACACTG
GGCAAGATCCTATT
ATTGGTGGACCTCCAGCCGCGAACACACCTGCGGCTGTCGCTACGGTGGAGTACGACAAACCTCCTGAAATAGAACCCAAGACGGGAGACCTAGTCAACCTTGCGACTACCAGTGAAGGA
AACATCATTGAAGTATCTGGCTTTGCCAAAGTCAGATCAGCCAGTGCAGTGGATCCACCTGGCGTTCCGCAAGAGTTCTTTGTTACTTCGCGCGGCGGTGAATACTTCTTCGTACCCCCC
ATCTCAACAGTCACAGAATGGGCTTCCTCTTAA

Retrieve as FASTA