Entry information : GluxDyPrx05
Entry ID 10203
Creation 2012-01-27 (Christophe Dunand)
Last sequence changes 2012-01-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-03 (Catherine Mathe (Scipio))
Peroxidase information: GluxDyPrx05
Name GluxDyPrx05
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Tricholomataceae Gymnopus
Organism Gymnopus luxurians    [TaxId: 206324 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GluxDyPrx05
start..stop
S start..stop
GluxDyPrx01 729 0 16..502 17..508
GluxDyPrx03 624 0 1..501 1..515
GluxDyPrx07 620 0 1..501 1..499
GluxDyPrx08 610 0 1..502 1..509
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 488441..488552 112 N° 2 488302..488386 85 N° 3 487794..488200 407 N° 4 487445..487740 296
N° 5 487154..487385 232 N° 6 487033..487101 69 N° 7 486908..486974 67 N° 8 486831..486841 11
N° 9 486680..486732 53 N° 10 486526..486625 100 N° 11 486403..486479 77  
complement(join(486403..486479,486526..486625,486680..486732,486831..486841,4869 08..486974,487033..487101,487154..487385,487445..487740,487794..488200,488302..4 88386,488441..488552))


exon

Literature and cross-references GluxDyPrx05
DNA ref. JGI genome:   scaffold_24 (488552..486403)
Cluster/Prediction ref. JGI gene:   261090
Protein sequence: GluxDyPrx05
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   503 (484)
PWM (Da):   %s   54049.17 (52022.0)  
PI (pH):   %s   4.39 (4.35) Peptide Signal:   %s   cut: 19 range:19-502
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKLIQASLLATLTWTVSAFPNLESSALKSRGSNSVLINPPGFPPLPSVNQVAASGLNLSNIQGDILVDDPAAFKSQLGSEILPLITPIIQILPDAPDPPATIVNIAFSQKGLNALGIQDNLNDADFTNGQLSNAAFLGDQTSNWEPAFASNNVHGVFLIESDTIDSVNAKLSQIQTISNGSISEVYRIQGQARPGDEQGHEHFGFLDGVSNPSLRGFVVPALPGQTIVDPGIILLGEEGDTVLERPDWAKDGSFLAFRQLQQRVPEFNKFLVDNALSEPGLSASENAQLLGARMMGRWKSGAPIDLTPLKDDPVLGADHNRNNVFNFTHPDDPNFDFKTNQSYCPFSAHIRKTNPRADIATSFKQHIIRGGIPYGPEVTDAENASNSSSTDPSLERGLAFVAYQSNIEQGFAFLQHSWANNNSFHIILLSDAPNQQFIANYNSVGEDPIIGVAPNDGPRSPAGLDPNNQTRTITINEDFVVSRGGEYFFSPSISAIQNTLSV*

Retrieve as FASTA  
Remarks Complete sequence from genomic (10 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAACTCATACAAGCCTCTCTGCTTGCGACCTTGACATGGACAGTGTCCGCCTTTCCAAACCTAGAGTCTTCTGCCTTGAAATCGCGAGGTTCCAACTCTGTTCTTATTAGTGAGCAA
ATTCAACTACATTCTCAATTTGTATGCTGAGTAGATACTCCATTAGATCCTCCTGGCTTTCCACCGCTACCTTCTGTCAATCAAGTAGCTGCTTCCGGGCTCAATCTGAGCAACATCCAA
GGCGACATTCT
GTAGGTCAATTCATCTCCTGTGCCTGTACTTGATTATATTCAACAGGATAAACACAAAGGACTGGTATGAGGAAAATGAAAGAGTTATTCTTTTTCTTCAGTGTCGATG
ATCCTGCGGCATTCAAGTCTCAGCTTGGATCAGAGATCCTGCCTCTGATTACCCCAATCATTCAGATACTTCCAGATGCTCCTGACCCTCCTGCCACGATCGTCAACATTGCCTTTTCTC
AAAAAGGTTTGAATGCACTAGGAATTCAGGATAACCTGAATGATGCAGATTTCACAAATGGACAATTGTCGAATGCTGCATTTCTCGGAGATCAAACGAGTAATTGGGAGCCCGCTTTCG
CCAGCAACAACGTTCATGGTGTCTTTCTGATCGAGTCGGACACGATAGACAGTGTGAATGCCAAGCTGTCGCAGATTCAGACCATCTCCAATGGTTCCATCTCTGAAGTCTACAGGATCC
AGGGTCAGGCCAGGCCTGGAGATGAACAGGGACATGAGC
GTAAGTTGTCTTAATTTCCTTTAAGATCAAATTATAAGATCTATTCTCTATAGATTTTGGGTTCTTAGATGGAGTTAGCAA
TCCCTCCCTCCGCGGTTTCGTAGTACCGGCTCTTCCTGGCCAGACAATTGTAGATCCTGGTATCATCCTTCTCGGGGAGGAGGGAGATACAGTACTAGAACGTCCAGATTGGGCCAAAGA
TGGCTCGTTCCTTGCCTTCCGTCAACTTCAGCAACGCGTCCCAGAGTTCAACAAGTTCTTAGTCGACAATGCTCTTTCTGAACCCGGTCTCAGTGCCAGTGAGAATGCCCAGCTCCTCGG
TGCTCGAATGATGGGACGTTGGAAAAGT
GTAAATACCACGCAATGCCTATGTCACCTAATATTCTTTTATTAACTGCCTTATTACAGGGTGCTCCAATTGACCTCACACCTCTCAAGGAT
GATCCTGTCCTAGGAGCGGATCATAACCGGAACAACGTTTTCAACTTTACGCATCCTGATGATCCCAACTTTGACTTTAAAACAAACCAGTCCTACTGTCCCTTCTCCGCACACATCCGG
AAGACCAACCCACGTGCAGACATAGCGACCTCATTCAAGCAACACATTATTCGTGGTGGAATTCCTTATGGACCTGAAG
GTATTTAATATTCTTTCATTAGGATATGTCGATAGATGACA
CACTTGTTTAGTTACTGATGCCGAAAATGCTTCCAATTCCTCTAGCACTGATCCTAGTCTTGAGCGAGGTCTAGCTTTTGGTAAGAGGATATACTGATTAATTGAATCTTGCGTAAAGTA
ATAACCGAGTGGTTGTAGTTGCATATCAATCGAACATTGAGCAAGGCTTTGCATTCCTTCAGCACTCTTGGGCAAACAACAACAGGTGAGTAGCATTGCATCATCTAGCAAGGTGTATTG
TCGATGAGCTGGCTATATTTTTTTTCTTCAGCTTCCACATAAGTGAGTAGCTGCCTTATGCTCCACGTACTGTTGCTTCCAACTGATTGATTTATCTAAAACACAGGCGGGTAAGTGTAA
AATAACTTTACATACACAAGTTCTCCTTTCTGATGCACCCAATCAACAATTCATTGCAAATTACAACAGTGTTGTAAGTTTACATTCTCTACGTATAATTGCATGTCCTTGATGTCGGAA
AATATAGGGCGAAGACCCGATTATCGGAGTTGCACCAAATGATGGACCTAGGTCTCCTGCTGGCCTTGACCCCAACAATCAAACGAGAACTATTACAATCAATGAAGGTTAGCACTCTCA
AATACATACAGATTTAAGCTCATAGCTGTCCAGATTTTGTCGTTTCACGCGGAGGGGAATATTTCTTTTCACCCTCAATCTCTGCCATTCAGAATACACTTTCAGTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAACTCATACAAGCCTCTCTGCTTGCGACCTTGACATGGACAGTGTCCGCCTTTCCAAACCTAGAGTCTTCTGCCTTGAAATCGCGAGGTTCCAACTCTGTTCTTATTAATCCTCCT
GGCTTTCCACCGCTACCTTCTGTCAATCAAGTAGCTGCTTCCGGGCTCAATCTGAGCAACATCCAAGGCGACATTCT
TGTCGATGATCCTGCGGCATTCAAGTCTCAGCTTGGATCAGAG
ATCCTGCCTCTGATTACCCCAATCATTCAGATACTTCCAGATGCTCCTGACCCTCCTGCCACGATCGTCAACATTGCCTTTTCTCAAAAAGGTTTGAATGCACTAGGAATTCAGGATAAC
CTGAATGATGCAGATTTCACAAATGGACAATTGTCGAATGCTGCATTTCTCGGAGATCAAACGAGTAATTGGGAGCCCGCTTTCGCCAGCAACAACGTTCATGGTGTCTTTCTGATCGAG
TCGGACACGATAGACAGTGTGAATGCCAAGCTGTCGCAGATTCAGACCATCTCCAATGGTTCCATCTCTGAAGTCTACAGGATCCAGGGTCAGGCCAGGCCTGGAGATGAACAGGGACAT
GAGC
ATTTTGGGTTCTTAGATGGAGTTAGCAATCCCTCCCTCCGCGGTTTCGTAGTACCGGCTCTTCCTGGCCAGACAATTGTAGATCCTGGTATCATCCTTCTCGGGGAGGAGGGAGAT
ACAGTACTAGAACGTCCAGATTGGGCCAAAGATGGCTCGTTCCTTGCCTTCCGTCAACTTCAGCAACGCGTCCCAGAGTTCAACAAGTTCTTAGTCGACAATGCTCTTTCTGAACCCGGT
CTCAGTGCCAGTGAGAATGCCCAGCTCCTCGGTGCTCGAATGATGGGACGTTGGAAAAGT
GGTGCTCCAATTGACCTCACACCTCTCAAGGATGATCCTGTCCTAGGAGCGGATCATAAC
CGGAACAACGTTTTCAACTTTACGCATCCTGATGATCCCAACTTTGACTTTAAAACAAACCAGTCCTACTGTCCCTTCTCCGCACACATCCGGAAGACCAACCCACGTGCAGACATAGCG
ACCTCATTCAAGCAACACATTATTCGTGGTGGAATTCCTTATGGACCTGAAG
TTACTGATGCCGAAAATGCTTCCAATTCCTCTAGCACTGATCCTAGTCTTGAGCGAGGTCTAGCTTTT
G
TTGCATATCAATCGAACATTGAGCAAGGCTTTGCATTCCTTCAGCACTCTTGGGCAAACAACAACAGCTTCCACATAATTCTCCTTTCTGATGCACCCAATCAACAATTCATTGCAAAT
TACAACAGTGTT
GGCGAAGACCCGATTATCGGAGTTGCACCAAATGATGGACCTAGGTCTCCTGCTGGCCTTGACCCCAACAATCAAACGAGAACTATTACAATCAATGAAGATTTTGTC
GTTTCACGCGGAGGGGAATATTTCTTTTCACCCTCAATCTCTGCCATTCAGAATACACTTTCAGTCTAA

Retrieve as FASTA