Entry information : GluxDyPrx10
Entry ID 10208
Creation 2012-01-27 (Christophe Dunand)
Last sequence changes 2012-01-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-03 (Catherine Mathe (Scipio))
Peroxidase information: GluxDyPrx10
Name GluxDyPrx10
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Tricholomataceae Gymnopus
Organism Gymnopus luxurians    [TaxId: 206324 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GluxDyPrx10
start..stop
S start..stop
GluxDyPrx09 894 0 4..525 163..684
CcinDyPrx02 381 6e-126 68..518 179..642
PcarDyPrx 362 2e-119 69..520 94..557
BaDyPrx08 358 6e-118 69..518 105..564
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 752418..752426 9 N° 2 752308..752363 56 N° 3 752091..752255 165 N° 4 751206..752035 830
N° 5 750987..751152 166 N° 6 750785..750918 134 N° 7 750510..750727 218  
complement(join(750510..750727,750785..750918,750987..751152,751206..752035,7520 91..752255,752308..752363,752418..752426))


exon

Literature and cross-references GluxDyPrx10
DNA ref. JGI genome:   scaffold_19 (752426..750510)
Cluster/Prediction ref. JGI gene:   506542
Protein sequence: GluxDyPrx10
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   525
PWM (Da):   %s   59020.18  
PI (pH):   %s   7.64
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSKITSREEGGLPTPRPADSDMYAKVISSESNNPPPAGTTDNVKLNGHINGQCNRRCPVLEEEDENPNLGNIQAEIVPGLNKAFEYFLFFRIENVNGFRDTMKAKMIPKISTAMQVFDMLKHKQFPANGVPNNDWDYVGCSVGFSSIGLAKLGLTDYLYDEAFHRGQRRDAKDLGDKGTESKGTFRVDWDAKFLEEIHGVFQITAHNDSKGKAFVSQLKKDFSYSNGIKQVMLISTKFRPMPHTRMEHFGFRDGISKPEIKGYTFDDELPIRFPGSPIADPGCLLMGRKGDLEKSRRPAWAVDGSFLVFRKLKQYVPEFHNFLRQNGTKLYPDLKPDDASHKLGARMFGRWKGTPVVLSPERDDESISNDDKQVNNFQYPADQSTCPFAAHTQKSYPRNNLPGSNDHLFRRASIPYGAELDASETSTTKNDRGLLFVCYQSSIERGFKYTQRFTNPNFPSANLQADSPGHDPVMGTAERYMTGLDPHKQSDEFSIPLQFVEARGGEYFFMPSISTLNKITTRS

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAAAGGTTCGTTGCGTATGTTCTTTATTTCTAAATATGTTAACCATATCTTGTACATAGATCACCTCGAGAGAAGAAGGCGGACTACCTACACCTCGTCCTGCGGATAGCGATATG
TGTGTCGGTCTTGGTCATCCTACTAATCGTTATTGACCTCTCACATTCTAGGTATGCTAAAGTAATCTCCTCTGAGTCCAATAACCCCCCGCCTGCCGGAACCACTGACAACGTAAAACT
CAATGGGCACATAAATGGCCAGTGCAACCGGCGGTGCCCGGTACTCGAGGAGGAGGACGAAAATCCGAATTTGGGCAATATTCAAGCTGAGATAGT
GTATGTTTTACCCGAGACAAAATG
CCTCAGCTCCCACTTACTTGTATTTCTCTAGACCTGGGCTCAATAAGGCATTCGAGTACTTCCTCTTCTTCAGAATTGAAAATGTCAACGGATTTCGAGATACAATGAAGGCCAAGATGA
TACCCAAGATTTCTACCGCTATGCAGGTTTTCGATATGCTCAAGCACAAGCAGTTTCCTGCGAATGGTGTGCCGAATAATGATTGGGATTATGTTGGATGCAGTGTCGGCTTCTCATCGA
TAGGTCTTGCCAAACTCGGGTTGACAGACTATTTGTACGATGAGGCATTTCACCGAGGACAGCGACGCGATGCGAAAGACCTTGGTGACAAAGGGACCGAGTCTAAAGGTACATTCCGGG
TTGACTGGGATGCCAAATTCCTCGAGGAGATACACGGAGTCTTCCAAATCACCGCTCATAACGACAGCAAAGGAAAAGCCTTTGTCTCTCAGCTCAAGAAAGACTTTTCATACTCCAATG
GAATCAAGCAGGTCATGTTAATATCCACAAAGTTCCGACCGATGCCGCACACCAGGATGGAGCACTTTGGCTTCCGGGACGGGATCTCGAAGCCAGAGATCAAAGGGTATACATTCGATG
ACGAGCTCCCTATTCGTTTCCCTGGATCTCCCATTGCTGACCCTGGATGTCTACTGATGGGACGAAAAGGAGACTTGGAGAAGAGCAGACGGCCTGCTTGGGCCGTTGATGGCTCATTCT
TGGTATTTAGGAAGCTCAAGCAATATGTTCCGGAGTTCCATAATTTCCTGCGACAAAATGGGACCAAGCTATATCCAGATTTAAAGCCTGATGATGCATCCCATAAGTTAGGAGCCAGGA
TGTTTGGACGTTGGAAGAGTG
GTGGGTCATTATACTTTCAGCATTCCGCAGTCTGAGTAACAACGTTTCCACAGGGACTCCCGTCGTCCTTTCTCCCGAGAGAGACGACGAGTCTATCTC
GAATGATGACAAGCAGGTCAACAACTTCCAATACCCTGCCGATCAATCGACTTGCCCATTCGCAGCTCACACGCAGAAATCTTATCCGCGAAATAATCTTCCTGGAAGCAACGATCATTT
GTGAGTAACCTCCTGGGGTTACACTTTATGTTTTAGCCACCTACTTATCTGCCTTCGACATTCAACAGATTCAGACGAGCTAGTATTCCTTACGGGGCGGAACTGGACGCGTCTGAAACA
TCAACAACCAAGAATGACCGAGGATTACTATTTGTGTGCTATCAGAGTAGTATTGAGCGCGGTTTCAAATACACACAACAGA
GTAAGTGGCATCATTCACCGCTCTTGATACCTCCATTA
AATACGCCTACATTATTAGGATTCACCAATCCTAACTTCCCTTCGGCGAACTTGCAAGCGGATTCTCCAGGTCATGATCCTGTTATGGGGACTGCTGAACGGTACATGACTGGGCTGGAT
CCGCATAAACAGAGCGATGAATTCTCCATACCTCTTCAGTTTGTCGAAGCAAGGGGCGGGGAGTACTTCTTCATGCCGTCGATTTCTACTTTGAACAAAATTACGACAAGGTCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAAAGATCACCTCGAGAGAAGAAGGCGGACTACCTACACCTCGTCCTGCGGATAGCGATATGTATGCTAAAGTAATCTCCTCTGAGTCCAATAACCCCCCGCCTGCCGGAACCACT
GACAACGTAAAACTCAATGGGCACATAAATGGCCAGTGCAACCGGCGGTGCCCGGTACTCGAGGAGGAGGACGAAAATCCGAATTTGGGCAATATTCAAGCTGAGATAGT
ACCTGGGCTC
AATAAGGCATTCGAGTACTTCCTCTTCTTCAGAATTGAAAATGTCAACGGATTTCGAGATACAATGAAGGCCAAGATGATACCCAAGATTTCTACCGCTATGCAGGTTTTCGATATGCTC
AAGCACAAGCAGTTTCCTGCGAATGGTGTGCCGAATAATGATTGGGATTATGTTGGATGCAGTGTCGGCTTCTCATCGATAGGTCTTGCCAAACTCGGGTTGACAGACTATTTGTACGAT
GAGGCATTTCACCGAGGACAGCGACGCGATGCGAAAGACCTTGGTGACAAAGGGACCGAGTCTAAAGGTACATTCCGGGTTGACTGGGATGCCAAATTCCTCGAGGAGATACACGGAGTC
TTCCAAATCACCGCTCATAACGACAGCAAAGGAAAAGCCTTTGTCTCTCAGCTCAAGAAAGACTTTTCATACTCCAATGGAATCAAGCAGGTCATGTTAATATCCACAAAGTTCCGACCG
ATGCCGCACACCAGGATGGAGCACTTTGGCTTCCGGGACGGGATCTCGAAGCCAGAGATCAAAGGGTATACATTCGATGACGAGCTCCCTATTCGTTTCCCTGGATCTCCCATTGCTGAC
CCTGGATGTCTACTGATGGGACGAAAAGGAGACTTGGAGAAGAGCAGACGGCCTGCTTGGGCCGTTGATGGCTCATTCTTGGTATTTAGGAAGCTCAAGCAATATGTTCCGGAGTTCCAT
AATTTCCTGCGACAAAATGGGACCAAGCTATATCCAGATTTAAAGCCTGATGATGCATCCCATAAGTTAGGAGCCAGGATGTTTGGACGTTGGAAGAGTG
GGACTCCCGTCGTCCTTTCT
CCCGAGAGAGACGACGAGTCTATCTCGAATGATGACAAGCAGGTCAACAACTTCCAATACCCTGCCGATCAATCGACTTGCCCATTCGCAGCTCACACGCAGAAATCTTATCCGCGAAAT
AATCTTCCTGGAAGCAACGATCATTT
ATTCAGACGAGCTAGTATTCCTTACGGGGCGGAACTGGACGCGTCTGAAACATCAACAACCAAGAATGACCGAGGATTACTATTTGTGTGCTAT
CAGAGTAGTATTGAGCGCGGTTTCAAATACACACAACAGA
GATTCACCAATCCTAACTTCCCTTCGGCGAACTTGCAAGCGGATTCTCCAGGTCATGATCCTGTTATGGGGACTGCTGAA
CGGTACATGACTGGGCTGGATCCGCATAAACAGAGCGATGAATTCTCCATACCTCTTCAGTTTGTCGAAGCAAGGGGCGGGGAGTACTTCTTCATGCCGTCGATTTCTACTTTGAACAAA
ATTACGACAAGGTCTTAA

Retrieve as FASTA