Entry information : GluxDyPrx11
Entry ID 10209
Creation 2012-01-27 (Christophe Dunand)
Last sequence changes 2012-01-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-03 (Catherine Mathe (Scipio))
Peroxidase information: GluxDyPrx11
Name GluxDyPrx11
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Tricholomataceae Gymnopus
Organism Gymnopus luxurians    [TaxId: 206324 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GluxDyPrx11
start..stop
S start..stop
GluxDyPrx02 976 0 1..536 1..570
GluxDyPrx12 646 0 17..535 8..563
PgigDyPrx03 510 1e-176 44..535 51..603
HpinDyPrx 466 2e-160 37..536 27..545
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 192798..192977 180 N° 2 192364..192742 379 N° 3 192155..192272 118 N° 4 191813..192107 295
N° 5 191524..191763 240 N° 6 191322..191466 145 N° 7 191021..191274 254  
complement(join(191021..191274,191322..191466,191524..191763,191813..192107,1921 55..192272,192364..192742,192798..192977))


exon

Literature and cross-references GluxDyPrx11
DNA ref. JGI genome:   scaffold_95 (192977..191021)
Cluster/Prediction ref. JGI gene:   208034
Protein sequence: GluxDyPrx11
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   537
PWM (Da):   %s   59006.96  
PI (pH):   %s   7.94
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSISYSFHPHDPEIIPPRRLIIPSIHPESTPGKILFGGISREPLPDLKDVQGDVVYLFPKRAENFIFFRIADVPSFKKALAKFKPSSAHDTASFICEIAKHNRKGAQADGKPPIIKKASYRIAFSRMGMDYLDVRDETGDARFGHRAMRDDKDMLGDQMQWDPEFNKKDFDPVHGSANKDDGTALHALFGTSIKVVIVLGGRARPGDNAGHEHFGYKDGISQPALRKLTTARPGQIQVNCGVVIIGFKGDPVIDGAGQCPAWTKGGTVMVFRKLQQYVQLFNAYLEKNGARWKDFVPPVPESQALTDKQGEELWGARLIGRWKSGAPIALCPYNDNPEVAANADMNNNFNYTIDGVNGLTDLFCPFSAHTRKTVPRNIDPYVQRAFLESSMMVRAGLPYGPEVQPDEDPDKDLRGLLFVSYQSSLDQGFVRQTVSFANNDYFPITSLVPQHTGQDPIIGGPPAANTSAAVAEVKYDKPPEKEPKTGDLVNLATTSEGNIIQVSGFAKVRPTVFVTSRGGEYFFVLPISTVTKWASS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCATTTCTTACAGTTTTCATCCACACGATCCGGAGATCATTCCTCCACGCCGGTTGATTATCCCTTCTATCCATCCTGAATCTACTCCAGGAAAAATCCTCTTCGGGGGGATCTCA
CGCGAGCCACTTCCAGACCTCAAAGACGTCCAAGGTGATGTTGTCTACCTCTTCCCCAAG
GTATGAGACGCTGTTCCACCCTGGTGTTCAATCTCCAAAAGATGTATACCTACAGCGGGC
CGAGAACTTTATTTTTTTTCGTATTGCCGATGTGCCCTCGTTCAAAAAAGCTCTCGCGAAATTCAAGCCATCGAGCGCCCATGATACTGCCAGCTTCATCTGCGAGATTGCCAAACATAA
TCGGAAAGGGGCTCAAGCTGATGGAAAGCCTCCTATCATCAAGAAAGCCAGTTATCGAATCGCATTCAGTCGCATGGGTATGGATTATCTAGATGTTCGCGATGAAACCGGGGATGCACG
TTTTGGCCATCGGGCAATGCGAGACGACAAGGACATGCTTGGTGACCAGATGCAATGGGATCCCGAGTTTAACAAAAAAGATTTCGATCCTGTCCATGGCTCGGCGAACAAAGATGACGG
AACAGCCCTTCATG
GTGTCATCACTGTCGCTGCAGGCGGTGAGCTTCTGAGAAGAAGCTTTCTTCACTGAGGATTGACATGTTGTGTATACAAAGGAGACTACAGCGCTCTTCGGCACAT
CCATCAAAGTTGTTATTGTGCTCGGAGGGAGGGCACGACCTGGCGATAACGCAGGACACGAGCACTTCGGCTACAAAGACGGCATCTCTCAGCCTGCCCTTCG
GTAAATGCCCTGTTGAA
CCTCAGATCTTGTCTTGATATTGTTATTAGCAAACTTACCACAGCAAGGCCGGGTCAGATCCAAGTGAACTGTGGCGTAGTGATTATCGGGTTCAAGGGAGATCCAGTTATTGATGGCGC
AGGCCAATGTCCCGCCTGGACAAAAGGCGGGACCGTGATGGTGTTCCGCAAGCTTCAGCAATACGTTCAATTGTTCAATGCTTACTTGGAGAAGAATGGCGCGCGCTGGAAGGACTTTGT
CCCGCCGGTCCCTGAAAGTCAGGCACTGACAGACAAGCAGGGTGAGGAGCTCTGGGGAGCTAGGTTGATCGGTCGTTGGAAATCC
GTAAGTCACAATCTTTGGATACCTGTTTCCCACTC
TAACCCTTCTGAAGGGGGCTCCTATAGCATTGTGTCCGTACAACGATAATCCCGAAGTGGCAGCAAATGCAGACATGAACAATAATTTTAACTATACTATTGACGGTGTCAATGGTCTCA
CTGACTTATTCTGCCCTTTCTCTGCGCATACACGCAAGACAGTCCCTCGAAATATAGACCCGTACGTTCAGCGGGCATTCCTTGAATCGAGTATGATGGTACGCGCTGGTCTCCCTTATG
GTCCCGAGGTCCAG
GTATTACTAGACGGCTCCTTCATCGGCTTGATTATAATTAATGGAACTATCTTGTAGCCTGACGAAGATCCGGACAAAGACCTGCGTGGACTTCTTTTTGTGTCCT
ATCAGTCTAGCTTGGACCAAGGCTTTGTTCGGCAAACGGTTTCTTTTGCGAATAATGACTACTTCCCCATCACATCACTAGTTCCCCAGCATACTG
GTACGTTTTTCGTTGCCAAAATAC
TACATTATGCTCATACTTCGCAGGGCAAGATCCTATCATCGGGGGACCTCCAGCTGCGAACACATCTGCAGCTGTAGCCGAAGTGAAGTATGATAAACCTCCTGAAAAAGAACCAAAGAC
CGGAGACCTAGTCAACCTTGCGACTACCAGCGAAGGAAATATCATTCAAGTATCTGGCTTTGCTAAAGTCAGACCGACTGTCTTTGTTACTTCGCGCGGCGGTGAATACTTCTTCGTACT
CCCTATCTCTACAGTCACAAAATGGGCTTCCTCGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCATTTCTTACAGTTTTCATCCACACGATCCGGAGATCATTCCTCCACGCCGGTTGATTATCCCTTCTATCCATCCTGAATCTACTCCAGGAAAAATCCTCTTCGGGGGGATCTCA
CGCGAGCCACTTCCAGACCTCAAAGACGTCCAAGGTGATGTTGTCTACCTCTTCCCCAAG
CGGGCCGAGAACTTTATTTTTTTTCGTATTGCCGATGTGCCCTCGTTCAAAAAAGCTCTC
GCGAAATTCAAGCCATCGAGCGCCCATGATACTGCCAGCTTCATCTGCGAGATTGCCAAACATAATCGGAAAGGGGCTCAAGCTGATGGAAAGCCTCCTATCATCAAGAAAGCCAGTTAT
CGAATCGCATTCAGTCGCATGGGTATGGATTATCTAGATGTTCGCGATGAAACCGGGGATGCACGTTTTGGCCATCGGGCAATGCGAGACGACAAGGACATGCTTGGTGACCAGATGCAA
TGGGATCCCGAGTTTAACAAAAAAGATTTCGATCCTGTCCATGGCTCGGCGAACAAAGATGACGGAACAGCCCTTCATG
CGCTCTTCGGCACATCCATCAAAGTTGTTATTGTGCTCGGA
GGGAGGGCACGACCTGGCGATAACGCAGGACACGAGCACTTCGGCTACAAAGACGGCATCTCTCAGCCTGCCCTTCG
CAAACTTACCACAGCAAGGCCGGGTCAGATCCAAGTGAACTGT
GGCGTAGTGATTATCGGGTTCAAGGGAGATCCAGTTATTGATGGCGCAGGCCAATGTCCCGCCTGGACAAAAGGCGGGACCGTGATGGTGTTCCGCAAGCTTCAGCAATACGTTCAATTG
TTCAATGCTTACTTGGAGAAGAATGGCGCGCGCTGGAAGGACTTTGTCCCGCCGGTCCCTGAAAGTCAGGCACTGACAGACAAGCAGGGTGAGGAGCTCTGGGGAGCTAGGTTGATCGGT
CGTTGGAAATCC
GGGGCTCCTATAGCATTGTGTCCGTACAACGATAATCCCGAAGTGGCAGCAAATGCAGACATGAACAATAATTTTAACTATACTATTGACGGTGTCAATGGTCTCACT
GACTTATTCTGCCCTTTCTCTGCGCATACACGCAAGACAGTCCCTCGAAATATAGACCCGTACGTTCAGCGGGCATTCCTTGAATCGAGTATGATGGTACGCGCTGGTCTCCCTTATGGT
CCCGAGGTCCAG
CCTGACGAAGATCCGGACAAAGACCTGCGTGGACTTCTTTTTGTGTCCTATCAGTCTAGCTTGGACCAAGGCTTTGTTCGGCAAACGGTTTCTTTTGCGAATAATGAC
TACTTCCCCATCACATCACTAGTTCCCCAGCATACTG
GGCAAGATCCTATCATCGGGGGACCTCCAGCTGCGAACACATCTGCAGCTGTAGCCGAAGTGAAGTATGATAAACCTCCTGAA
AAAGAACCAAAGACCGGAGACCTAGTCAACCTTGCGACTACCAGCGAAGGAAATATCATTCAAGTATCTGGCTTTGCTAAAGTCAGACCGACTGTCTTTGTTACTTCGCGCGGCGGTGAA
TACTTCTTCGTACTCCCTATCTCTACAGTCACAAAATGGGCTTCCTCGTAA

Retrieve as FASTA