Entry information : GluxDyPrx12
Entry ID 10210
Creation 2012-01-27 (Christophe Dunand)
Last sequence changes 2012-01-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-03 (Catherine Mathe (Scipio))
Peroxidase information: GluxDyPrx12
Name GluxDyPrx12
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Tricholomataceae Gymnopus
Organism Gymnopus luxurians    [TaxId: 206324 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GluxDyPrx12
start..stop
S start..stop
GluxDyPrx02 724 0 8..563 17..569
GluxDyPrx11 646 0 8..563 17..535
PgigDyPrx03 612 0 6..570 11..610
SbreDyPrx01 583 0 1..563 8..582
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1323113..1323280 168 N° 2 1322658..1323060 403 N° 3 1322445..1322601 157 N° 4 1322094..1322391 298
N° 5 1321796..1322044 249 N° 6 1321602..1321740 139 N° 7 1321258..1321556 299  
complement(join(1321258..1321556,1321602..1321740,1321796..1322044,1322094..1322 391,1322445..1322601,1322658..1323060,1323113..1323280))


exon

Literature and cross-references GluxDyPrx12
DNA ref. JGI genome:   scaffold_4 (1323280..1321258)
Cluster/Prediction ref. JGI gene:   68574 [Incorrect splicing]
Protein sequence: GluxDyPrx12
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   570
PWM (Da):   %s   62245.17  
PI (pH):   %s   7
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDLSDHLPSRSIIPLIYPLPVTRGEKATCRIGNEAPSEELPDLKDVQGDVVFLFSKRAENFIFFRIANLASFRAALARFQPSNSYDTGSFVWELYQHRRSAFQAGVKPSIIKRAGYQIAFTRMGMNFLGVRSPTGDTRFDKRAMRDDKGMLGDQAQWDPVFDKKNADPVNGSADKDDETTLHGVITVVGSDPDSCKQYSDETKALFGSSIKVVSTLEGRARPGANAGHEHFGYEDGVSQPALRNLSNPNPGQIQVNPGVIIMGYKGDPVVDYPDIAGGRPAWTKGGTMMVFRKLEQDVPAFNEYLKKNGRRWKEFAPPGCPELTDEEGAELWGARLIGRWKGAPVALCPYKDDPQLAVDSKRNNNFDYRVRGVPGVSPREHSALYCPFFAHTRKTVPRNLDPYIQQAFLESSMIVRGGLPYGPELEEDQNKERGLLFVCYQSSLDGGFIQQTAFAGNDYFPTTSLVPQYHGKDTVLGGPPVGPAAVTKINYVEAPKTPPSSGDPVNLVTTYNGNNIEVSGFAKVTPSSAVNPPGVPPEFFVTSHGGEYFFVPPISTLKKWASGGGSPGL

Retrieve as FASTA  
Remarks Complete sequence from genomic (? introns). Incorrect prediction from JGI (very long 3' end)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACCTCTCTGACCATCTCCCTAGCCGATCGATTATTCCTCTGATCTATCCTTTGCCAGTTACTCGAGGAGAGAAGGCCACCTGTCGTATTGGCAATGAAGCACCATCTGAGGAGCTT
CCGGACCTGAAAGACGTTCAAGGAGATGTGGTCTTCCTCTTCTCCAAA
GTACGAGACGCTGCTCCATCCTACATTCAATTCTAAAGAGAAATGCTGACAGCGAGCAGAGAATTTCATATT
CTTTCGTATTGCTAACCTGGCCTCGTTCAGAGCTGCTCTTGCTCGATTCCAACCATCTAACTCCTATGATACTGGCAGCTTCGTTTGGGAGCTCTATCAACACAGGCGAAGTGCATTTCA
AGCTGGCGTCAAGCCTTCCATTATCAAGAGAGCTGGCTACCAGATTGCATTCACCCGCATGGGTATGAATTTTCTAGGTGTTCGAAGTCCGACCGGGGACACACGCTTTGACAAGCGCGC
AATGCGAGACGACAAGGGCATGCTGGGCGACCAAGCACAGTGGGATCCTGTATTTGATAAGAAAAATGCAGACCCTGTTAATGGCTCGGCGGACAAGGATGATGAAACAACACTTCACGG
TGTTATTACTGTCGTAGGAAGCG
GTGAGCGACTTGGGATGCGTCATTTGAGTGTGGAGCTGGTTTACATTGTTGTACAGATCCGGACAGTTGCAAACAATATTCAGATGAAACTAAAGCG
CTGTTTGGCTCATCTATTAAAGTTGTTAGTACGCTCGAGGGTAGAGCCCGACCTGGTGCTAACGCAGGGCACGAGCATTTTGGGTACGAAGACGGAGTATCTCAGCCTGCTCTTCG
GTAA
TAATAATTGTCCTCTTGAGTTTCTAATCGCGTCCTAACACTCTTTTCAGCAATCTCTCTAACCCAAACCCGGGTCAAATTCAAGTCAATCCAGGCGTGATTATTATGGGATACAAGGGAG
ATCCAGTAGTTGATTACCCGGATATCGCAGGCGGACGTCCCGCTTGGACGAAAGGCGGAACGATGATGGTGTTCCGCAAGCTCGAACAGGACGTTCCCGCATTCAATGAATACTTGAAGA
AAAATGGCCGCCGTTGGAAGGAGTTTGCCCCGCCGGGATGTCCAGAGCTTACCGACGAGGAAGGTGCAGAGCTCTGGGGAGCTAGGCTTATCGGTCGTTGGAAGTCT
GTGCGTTACGGTT
TTTGGATACACATCTATAAACTTAATATTCCTCAAGGGTGCCCCTGTAGCACTGTGTCCGTACAAAGATGATCCTCAGTTGGCAGTAGACTCTAAAAGGAACAATAACTTTGACTATCGC
GTTCGTGGTGTCCCTGGCGTGTCACCTAGGGAACATAGCGCTCTATACTGCCCTTTCTTTGCGCATACACGCAAGACCGTTCCCCGAAATCTCGACCCGTACATTCAGCAGGCATTCCTC
GAGTCGAGCATGATTGTACGCGGTGGTCTCCCTTATGGTCCAGAG
GTAAGGCTAAATGACTTATTCATAAGTTTGATATAACCAATGCTTGCAATTTTAGCTTGAAGAAGATCAGAATAA
AGAACGTGGACTCCTTTTCGTGTGCTATCAGTCTAGCTTGGATGGTGGTTTTATTCAACAAACAGCTTTCGCGGGCAATGACTACTTCCCCACCACGTCCTTGGTTCCCCAATATCACG
G
TAAGTCATTCATCTTTCATTCTACCTCATGCTCACAGCTCGCAGGCAAAGATACTGTGCTTGGTGGACCTCCCGTTGGACCTGCTGCCGTCACTAAGATAAATTATGTCGAAGCCCCGAA
AACACCACCAAGTTCGGGAGATCCAGTCAATCTCGTCACCACTTACAACGGCAATAATATTGAAGTGTCTGGCTTCGCCAAAGTTACGCCGTCAAGCGCAGTGAATCCGCCTGGTGTTCC
ACCAGAATTTTTTGTTACATCACATGGCGGCGAATACTTCTTTGTCCCACCAATCTCAACGCTCAAAAAGTGGGCTTCCGGTGGCGGATCTCCAGGCCTGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACCTCTCTGACCATCTCCCTAGCCGATCGATTATTCCTCTGATCTATCCTTTGCCAGTTACTCGAGGAGAGAAGGCCACCTGTCGTATTGGCAATGAAGCACCATCTGAGGAGCTT
CCGGACCTGAAAGACGTTCAAGGAGATGTGGTCTTCCTCTTCTCCAAA
CGAGCAGAGAATTTCATATTCTTTCGTATTGCTAACCTGGCCTCGTTCAGAGCTGCTCTTGCTCGATTCCAA
CCATCTAACTCCTATGATACTGGCAGCTTCGTTTGGGAGCTCTATCAACACAGGCGAAGTGCATTTCAAGCTGGCGTCAAGCCTTCCATTATCAAGAGAGCTGGCTACCAGATTGCATTC
ACCCGCATGGGTATGAATTTTCTAGGTGTTCGAAGTCCGACCGGGGACACACGCTTTGACAAGCGCGCAATGCGAGACGACAAGGGCATGCTGGGCGACCAAGCACAGTGGGATCCTGTA
TTTGATAAGAAAAATGCAGACCCTGTTAATGGCTCGGCGGACAAGGATGATGAAACAACACTTCACGGTGTTATTACTGTCGTAGGAAGCG
ATCCGGACAGTTGCAAACAATATTCAGAT
GAAACTAAAGCGCTGTTTGGCTCATCTATTAAAGTTGTTAGTACGCTCGAGGGTAGAGCCCGACCTGGTGCTAACGCAGGGCACGAGCATTTTGGGTACGAAGACGGAGTATCTCAGCCT
GCTCTTCG
CAATCTCTCTAACCCAAACCCGGGTCAAATTCAAGTCAATCCAGGCGTGATTATTATGGGATACAAGGGAGATCCAGTAGTTGATTACCCGGATATCGCAGGCGGACGTCCC
GCTTGGACGAAAGGCGGAACGATGATGGTGTTCCGCAAGCTCGAACAGGACGTTCCCGCATTCAATGAATACTTGAAGAAAAATGGCCGCCGTTGGAAGGAGTTTGCCCCGCCGGGATGT
CCAGAGCTTACCGACGAGGAAGGTGCAGAGCTCTGGGGAGCTAGGCTTATCGGTCGTTGGAAGTCT
GGTGCCCCTGTAGCACTGTGTCCGTACAAAGATGATCCTCAGTTGGCAGTAGAC
TCTAAAAGGAACAATAACTTTGACTATCGCGTTCGTGGTGTCCCTGGCGTGTCACCTAGGGAACATAGCGCTCTATACTGCCCTTTCTTTGCGCATACACGCAAGACCGTTCCCCGAAAT
CTCGACCCGTACATTCAGCAGGCATTCCTCGAGTCGAGCATGATTGTACGCGGTGGTCTCCCTTATGGTCCAGAG
CTTGAAGAAGATCAGAATAAAGAACGTGGACTCCTTTTCGTGTGC
TATCAGTCTAGCTTGGATGGTGGTTTTATTCAACAAACAGCTTTCGCGGGCAATGACTACTTCCCCACCACGTCCTTGGTTCCCCAATATCACG
GCAAAGATACTGTGCTTGGTGGACCT
CCCGTTGGACCTGCTGCCGTCACTAAGATAAATTATGTCGAAGCCCCGAAAACACCACCAAGTTCGGGAGATCCAGTCAATCTCGTCACCACTTACAACGGCAATAATATTGAAGTGTCT
GGCTTCGCCAAAGTTACGCCGTCAAGCGCAGTGAATCCGCCTGGTGTTCCACCAGAATTTTTTGTTACATCACATGGCGGCGAATACTTCTTTGTCCCACCAATCTCAACGCTCAAAAAG
TGGGCTTCCGGTGGCGGATCTCCAGGCCTGTGA

Retrieve as FASTA