Entry information : PgigDyPrx (DyP)
Entry ID 10211
Creation 2012-01-27 (Christophe Dunand)
Last sequence changes 2012-01-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-27 (Catherine Mathe (Scipio))
Peroxidase information: PgigDyPrx (DyP)
Name (synonym) PgigDyPrx (DyP)
Class DyP-type peroxidase D    [Orthogroup: DyPrxD003]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Phanerochaetaceae Phlebiopsis
Organism Phlebiopsis gigantea    [TaxId: 82310 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PgigDyPrx
start..stop
S start..stop
PgigDyPrx04 666 0 10..530 2..525
PplDyPrx01 447 2e-150 15..528 11..544
BaDyPrx07 429 1e-144 15..528 11..496
PplDyPrx02 373 8e-123 15..525 11..510
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 225509..225676 168 N° 2 225139..225454 316 N° 3 224932..225085 154 N° 4 224574..224880 307
N° 5 224288..224518 231 N° 6 224085..224238 154 N° 7 223772..224034 263  
complement(join(223772..224034,224085..224238,224288..224518,224574..224880,2249 32..225085,225139..225454,225509..225676))


exon

Literature and cross-references PgigDyPrx (DyP)
DNA ref. JGI genome:   scaffold_19 (225676..223772)
Cluster/Prediction ref. JGI gene:   125681
Protein sequence: PgigDyPrx (DyP)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   531
PWM (Da):   %s   58778.01  
PI (pH):   %s   6.91
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTSYQQSKSLTTELLEHISKRPLLPAPRSPGQAASFTNNLPDPKNIQGDVYLTFPRDSEKLLFFTVTDPTLFLKNLAKYKPTTTDDVVHISLWKIAEAKAAGERAVVIQSQIAFTREGLDILGHKEPIQDDAFDVRSEPQSDADAPFNSKVFHGVFLVGACAKRTADEGAQAILDIFGNSMSVDVLEGNSRPDKERGHEHFGWKDGISQPALRGLVMPQKGQPQCDAGVVIMGYPGDRLYNHPRIVRPSWSRGGSLMVFRKMKQLVPEFRKYVNDAGGKWTEWMPKAEVPKIQPPLSDIEGAALFGARLFGRWKGAPLARALHRDDPSQTTADKMNDFDYIVDGEDNPTQTLCPFTAHIRKTVPRNLEPFATKPFLESTLLVRSGIPYGPEVDSNVEKEKTVHDRGLLFICYQSTLGNGFIAQQSWTRNDYFPTINFEVNKWGQDSVIGQPPPPKTVVQVAMSGHKIPKGEISLEVQSNPPDAASITVVDGFANDLVKPAVEPQFFVQDRGGAFFFVPSVETLRLWARA

Retrieve as FASTA  
Remarks Compleet sequence from genomic (6 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACCAGTTACCAGCAGTCCAAGTCGCTTACCACGGAGCTGCTGGAACATATTTCCAAGCGGCCCCTTCTTCCAGCGCCTCGTTCCCCGGGCCAGGCGGCGTCGTTCACCAACAACTTG
CCCGACCCCAAGAACATCCAAGGCGACGTTTACCTGACCTTCCCGAGG
GTGGGTGGCACGAACTCCTCGTAGTGCCCTTATAGTCACTAACGCACGCTTCAGGACTCGGAGAAGCTGCTG
TTCTTTACGGTCACTGACCCCACTCTATTCCTCAAGAACCTCGCCAAATACAAACCCACCACGACCGACGATGTCGTGCACATCAGCCTTTGGAAGATAGCCGAGGCCAAGGCGGCGGGC
GAGCGCGCGGTAGTCATCCAGTCTCAGATCGCCTTCACTCGCGAGGGCCTCGACATCCTCGGCCACAAGGAGCCCATACAAGATGATGCCTTTGACGTACGCTCTGAACCCCAGAGCGAC
GCGGATGCACCCTTCAATAGCAAGGTCTTCCACGGCGTCTTCCTGGTCGGCGCATGCG
GTACAGTGTTCCTCTGCACTGTTCCACATCGTGTAACATATTCTCCGGTACAGCTAAGCGGA
CTGCAGACGAAGGCGCACAAGCGATCCTCGACATATTCGGCAATTCCATGTCGGTAGATGTCCTCGAGGGCAATTCCCGTCCTGACAAAGAGCGCGGCCACGAGCACTTTGGCTGGAAGG
ACGGTATTTCCCAGCCTGCGCTACG
GTCAGCGCGTTTCGTTCTTTCCGGAGCACCATCTAACAATCGCTCCCTCAGTGGATTGGTCATGCCGCAGAAGGGCCAGCCTCAGTGCGACGCGG
GAGTGGTCATCATGGGCTACCCTGGAGACCGGCTTTATAACCACCCCCGCATCGTGCGGCCGTCCTGGTCCAGGGGTGGCTCCCTCATGGTGTTCCGTAAGATGAAACAGCTGGTCCCTG
AGTTCAGGAAGTACGTCAACGACGCCGGAGGTAAATGGACCGAGTGGATGCCCAAGGCCGAGGTGCCGAAGATCCAACCTCCCCTATCTGACATAGAGGGTGCGGCACTCTTCGGGGCCC
GCTTATTTGGCCGTTGGAAGTCG
GTGAGTCTCTGTAATCTATGGTCGCAGACTACGTATGGTGCTCACGTCTGCGTAGGGTGCGCCACTTGCTAGGGCACTGCATCGCGACGACCCCAGC
CAAACCACCGCAGACAAAATGAACGACTTCGACTACATTGTCGACGGCGAAGACAATCCTACACAGACGCTCTGCCCGTTCACGGCCCACATCCGCAAGACTGTTCCCAGGAATCTCGAG
CCGTTTGCCACGAAGCCTTTCCTGGAATCGACACTCCTCGTCCGGTCGGGCATACCCTACGGTCCTGAG
GTGCGTTCAAGTGCGCGTCCAGAGAACGATGACACTGACGCGCATACAGGT
CGATAGCAACGTGGAGAAGGAAAAGACAGTGCATGACCGCGGCCTACTATTTATTTGCTACCAGTCGACGCTTGGGAACGGTTTCATAGCTCAGCAGTCTTGGACGCGTAACGATTATTT
CCCCACGATCAATTTTGAGGTCAATAAATGGG
GTACGGACTCAATTTTCTTCGCTCAAGTCAGACTGTTGACGTGGGTATAGGCCAGGACAGTGTGATCGGTCAGCCTCCGCCGCCGAAG
ACGGTTGTACAGGTGGCGATGTCAGGGCACAAGATCCCCAAGGGTGAGATTTCGCTCGAGGTGCAGAGCAACCCGCCGGATGCTGCGAGCATTACCGTCGTCGATGGATTTGCAAACGAC
TTGGTGAAACCGGCGGTTGAGCCTCAGTTCTTTGTGCAGGATCGCGGGGGTGCCTTCTTCTTTGTACCGTCTGTGGAAACTCTCAGATTGTGGGCGCGAGCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACCAGTTACCAGCAGTCCAAGTCGCTTACCACGGAGCTGCTGGAACATATTTCCAAGCGGCCCCTTCTTCCAGCGCCTCGTTCCCCGGGCCAGGCGGCGTCGTTCACCAACAACTTG
CCCGACCCCAAGAACATCCAAGGCGACGTTTACCTGACCTTCCCGAGG
GACTCGGAGAAGCTGCTGTTCTTTACGGTCACTGACCCCACTCTATTCCTCAAGAACCTCGCCAAATACAAA
CCCACCACGACCGACGATGTCGTGCACATCAGCCTTTGGAAGATAGCCGAGGCCAAGGCGGCGGGCGAGCGCGCGGTAGTCATCCAGTCTCAGATCGCCTTCACTCGCGAGGGCCTCGAC
ATCCTCGGCCACAAGGAGCCCATACAAGATGATGCCTTTGACGTACGCTCTGAACCCCAGAGCGACGCGGATGCACCCTTCAATAGCAAGGTCTTCCACGGCGTCTTCCTGGTCGGCGCA
TGCG
CTAAGCGGACTGCAGACGAAGGCGCACAAGCGATCCTCGACATATTCGGCAATTCCATGTCGGTAGATGTCCTCGAGGGCAATTCCCGTCCTGACAAAGAGCGCGGCCACGAGCAC
TTTGGCTGGAAGGACGGTATTTCCCAGCCTGCGCTACG
TGGATTGGTCATGCCGCAGAAGGGCCAGCCTCAGTGCGACGCGGGAGTGGTCATCATGGGCTACCCTGGAGACCGGCTTTAT
AACCACCCCCGCATCGTGCGGCCGTCCTGGTCCAGGGGTGGCTCCCTCATGGTGTTCCGTAAGATGAAACAGCTGGTCCCTGAGTTCAGGAAGTACGTCAACGACGCCGGAGGTAAATGG
ACCGAGTGGATGCCCAAGGCCGAGGTGCCGAAGATCCAACCTCCCCTATCTGACATAGAGGGTGCGGCACTCTTCGGGGCCCGCTTATTTGGCCGTTGGAAGTCG
GGTGCGCCACTTGCT
AGGGCACTGCATCGCGACGACCCCAGCCAAACCACCGCAGACAAAATGAACGACTTCGACTACATTGTCGACGGCGAAGACAATCCTACACAGACGCTCTGCCCGTTCACGGCCCACATC
CGCAAGACTGTTCCCAGGAATCTCGAGCCGTTTGCCACGAAGCCTTTCCTGGAATCGACACTCCTCGTCCGGTCGGGCATACCCTACGGTCCTGAG
GTCGATAGCAACGTGGAGAAGGAA
AAGACAGTGCATGACCGCGGCCTACTATTTATTTGCTACCAGTCGACGCTTGGGAACGGTTTCATAGCTCAGCAGTCTTGGACGCGTAACGATTATTTCCCCACGATCAATTTTGAGGTC
AATAAATGGG
GCCAGGACAGTGTGATCGGTCAGCCTCCGCCGCCGAAGACGGTTGTACAGGTGGCGATGTCAGGGCACAAGATCCCCAAGGGTGAGATTTCGCTCGAGGTGCAGAGCAAC
CCGCCGGATGCTGCGAGCATTACCGTCGTCGATGGATTTGCAAACGACTTGGTGAAACCGGCGGTTGAGCCTCAGTTCTTTGTGCAGGATCGCGGGGGTGCCTTCTTCTTTGTACCGTCT
GTGGAAACTCTCAGATTGTGGGCGCGAGCTTAA

Retrieve as FASTA