Entry information : PgigDyPrx02
Entry ID 10212
Creation 2012-01-27 (Christophe Dunand)
Last sequence changes 2012-03-28 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-01-27 (Christophe Dunand)
Peroxidase information: PgigDyPrx02
Name PgigDyPrx02
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Phanerochaetaceae Phlebiopsis
Organism Phlebiopsis gigantea    [TaxId: 82310 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PgigDyPrx02
start..stop
S start..stop
BaDyPrx06 664 0 1..505 1..497
BaDyPrx02 660 0 29..506 18..495
TcuDyPrx01 648 0 29..505 24..497
BaDyPrx03 640 0 30..505 25..497
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 6537..6669 133 N° 2 6731..6833 103 N° 3 6892..7222 331 N° 4 7275..7389 115
N° 5 7448..8026 579 N° 6 8081..8147 67 N° 7 8206..8398 193  
join(6537..6669,6731..6833,6892..7222,7275..7389,7448..8026,8081..8147,8206..839 8)


exon

Literature and cross-references PgigDyPrx02
DNA ref. JGI genome:   scaffold_214 (6537..8398)
Cluster/Prediction ref. JGI gene:   78526 [3' end]
Protein sequence: PgigDyPrx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   506
PWM (Da):   %s   53972.49  
PI (pH):   %s   5.06
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRLVPLLTAALSFLQPHRDVLGAAAPENHLTERQSSGRSTPLLATFPGQAVLPTLQEILTLNATNGTFLPLQNIQGDILVGMKKQTERLVFFQINSASGFRSALKTYLPQITSTATLISPAANQPLAFVNIGFSQTGLTALGITDDLNDAEFASGMWADAANLGDDPSKWVSPFKGTAIHGVFVLGSDASYLDQYQSAISSTFGSSISVLTTISGAARPGDQAGHEHFGFLDGISQPAIGGWTTNTLPGQAIVPNGVILARRLGDTATRPSWALDGTFMAFRWFQQLVPEFNKWTLDNAVQPPPLAGVTLNAQDAADFLGARMFGRWKSGAPLDLAPTVDDPALGADPQRNNLFDYGDALLDETKCPFSAHIRKTNPRLDLPLLSINNHAIRSSIAYGPEVSASESASNTTSQDRGLIFVEYQSVIANGFRFQQIAWANTANFPPAKLETPGLDAVIGQGTPRTSGGLDPNNQTKMFTVPQFVVPKGGEYFFVPSIPALTSEFAT

Retrieve as FASTA  
Remarks Partials eqiuence from genomic (5 introns). Incorrect predictions from JGI => first exon is missing.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGTCTTGTGCCTCTCCTCACCGCTGCACTATCATTCCTCCAGCCCCATCGAGATGTCCTCGGTGCAGCTGCTCCCGAGAACCACCTGACAGAGAGGCAGTCGTCTGGAAGGTCAACG
CCCTTGCTCGCTA
GTGAGTCACCTCTAGGATGGGGCTGCTCGTGATCCTTCTCTCATACTCTTTTCCCACGTAGCGTTTCCTGGACAGGCTGTGCTGCCTACGCTCCAGGAGATTCTCAC
TCTGAATGCCACCAACGGGACCTTTCTCCCACTGCAGAATATTCAGGGTGATATCCT
GTACGTTACCGACCCGCCTTGCGCCCGAGAACATACCTTACTGACATATTGTATGCAGAGTTG
GCATGAAGAAGCAGACAGAAAGACTAGTGTTCTTCCAGATCAATAGCGCCAGTGGCTTCAGGAGCGCCCTCAAAACATACCTTCCCCAGATTACGTCTACTGCCACTCTCATCTCCCCTG
CTGCGAACCAGCCCCTTGCCTTCGTCAACATCGGGTTCTCTCAGACGGGGCTCACTGCCCTTGGGATTACAGACGACCTTAATGACGCAGAATTCGCCTCGGGAATGTGGGCCGACGCTG
CCAACCTCGGCGATGATCCCTCCAAGTGGGTCTCGCCGTTCAAGGGCACCGCCATCCATGGAGTATTTGTTCTCGGCAGCGACCAG
GTGGGTCTCCGCTCAAAACCTAGCACTCGTGTCT
GACCTCTTGCATCGGAAGGCTTCATACCTCGACCAATATCAGAGCGCGATCTCGTCGACGTTTGGCAGCTCAATCTCCGTCTTGACCACCATCAGCGGCGCTGCACGCCCCGGTGATCAG
GCCGGACACGAAC
GTCAGAGTTTTGTACCCCACTATGTTTGGTGTTCGGTCTGACCTTTGTTGGCTTCCAGATTTTGGATTCCTGGATGGTATCTCCCAACCCGCCATTGGAGGGTGGAC
GACCAACACCCTTCCTGGTCAGGCCATCGTGCCCAACGGCGTGATCCTAGCCCGCCGCCTCGGCGACACGGCAACGCGGCCCTCGTGGGCACTGGACGGCACCTTCATGGCGTTCCGCTG
GTTCCAGCAGCTCGTGCCCGAGTTCAACAAGTGGACGCTCGACAACGCCGTGCAGCCTCCGCCGTTGGCGGGCGTCACGCTCAACGCACAGGACGCGGCGGACTTCCTCGGCGCGCGCAT
GTTCGGGCGCTGGAAGAGCGGCGCGCCGCTCGACCTCGCGCCGACGGTGGACGACCCCGCCCTCGGCGCGGACCCGCAGCGGAACAACTTGTTCGATTATGGCGACGCACTGCTCGACGA
GACCAAGTGCCCGTTCAGCGCGCATATACGCAAGACGAACCCCCGTCTCGACTTGCCGCTCCTCTCGATCAACAACCATGCCATTCGCTCGAGCATCGCGTACGGACCTGAGGTGTCTGC
GTCGGAGTCCGCTTCGAATACGACTTCTCAAGACCGGGGCTTAATCTTCG
GTGAGTGTTGGAGTACTGTCTTGTTTGAGAATGCACTCTAACCGCCATGCGTAGTCGAATATCAATCAGT
GATAGCCAACGGCTTCCGCTTCCAGCAGATTGCGTGGGCTAACACGGCCAA
GTACGTCCTTTCCAGCACAGACACTGGCAAAAACGACTCAGAGTTGACGTGCACACAGCTTCCCGCCCG
CAAAGCTGGAGACACCTGGACTCGACGCCGTCATTGGGCAAGGCACCCCGCGTACGTCGGGCGGACTCGACCCGAACAATCAGACGAAGATGTTCACCGTGCCCCAGTTCGTCGTGCCCA
AGGGCGGGGAGTACTTCTTCGTCCCGTCCATCCCTGCGCTTACGAGCGAGTTCGCAACCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGTCTTGTGCCTCTCCTCACCGCTGCACTATCATTCCTCCAGCCCCATCGAGATGTCCTCGGTGCAGCTGCTCCCGAGAACCACCTGACAGAGAGGCAGTCGTCTGGAAGGTCAACG
CCCTTGCTCGCTA
CGTTTCCTGGACAGGCTGTGCTGCCTACGCTCCAGGAGATTCTCACTCTGAATGCCACCAACGGGACCTTTCTCCCACTGCAGAATATTCAGGGTGATATCCTAGTT
GGCATGAAGAAGCAGACAGAAAGACTAGTGTTCTTCCAGATCAATAGCGCCAGTGGCTTCAGGAGCGCCCTCAAAACATACCTTCCCCAGATTACGTCTACTGCCACTCTCATCTCCCCT
GCTGCGAACCAGCCCCTTGCCTTCGTCAACATCGGGTTCTCTCAGACGGGGCTCACTGCCCTTGGGATTACAGACGACCTTAATGACGCAGAATTCGCCTCGGGAATGTGGGCCGACGCT
GCCAACCTCGGCGATGATCCCTCCAAGTGGGTCTCGCCGTTCAAGGGCACCGCCATCCATGGAGTATTTGTTCTCGGCAGCGACCAG
GCTTCATACCTCGACCAATATCAGAGCGCGATC
TCGTCGACGTTTGGCAGCTCAATCTCCGTCTTGACCACCATCAGCGGCGCTGCACGCCCCGGTGATCAGGCCGGACACGAAC
ATTTTGGATTCCTGGATGGTATCTCCCAACCCGCCATT
GGAGGGTGGACGACCAACACCCTTCCTGGTCAGGCCATCGTGCCCAACGGCGTGATCCTAGCCCGCCGCCTCGGCGACACGGCAACGCGGCCCTCGTGGGCACTGGACGGCACCTTCATG
GCGTTCCGCTGGTTCCAGCAGCTCGTGCCCGAGTTCAACAAGTGGACGCTCGACAACGCCGTGCAGCCTCCGCCGTTGGCGGGCGTCACGCTCAACGCACAGGACGCGGCGGACTTCCTC
GGCGCGCGCATGTTCGGGCGCTGGAAGAGCGGCGCGCCGCTCGACCTCGCGCCGACGGTGGACGACCCCGCCCTCGGCGCGGACCCGCAGCGGAACAACTTGTTCGATTATGGCGACGCA
CTGCTCGACGAGACCAAGTGCCCGTTCAGCGCGCATATACGCAAGACGAACCCCCGTCTCGACTTGCCGCTCCTCTCGATCAACAACCATGCCATTCGCTCGAGCATCGCGTACGGACCT
GAGGTGTCTGCGTCGGAGTCCGCTTCGAATACGACTTCTCAAGACCGGGGCTTAATCTTCG
TCGAATATCAATCAGTGATAGCCAACGGCTTCCGCTTCCAGCAGATTGCGTGGGCTAAC
ACGGCCAA
CTTCCCGCCCGCAAAGCTGGAGACACCTGGACTCGACGCCGTCATTGGGCAAGGCACCCCGCGTACGTCGGGCGGACTCGACCCGAACAATCAGACGAAGATGTTCACCGTG
CCCCAGTTCGTCGTGCCCAAGGGCGGGGAGTACTTCTTCGTCCCGTCCATCCCTGCGCTTACGAGCGAGTTCGCAACCTGA

Retrieve as FASTA