Entry information : PgigDyPrx03
Entry ID 10213
Creation 2012-01-27 (Christophe Dunand)
Last sequence changes 2012-01-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-27 (Catherine Mathe (Scipio))
Peroxidase information: PgigDyPrx03
Name PgigDyPrx03
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Phanerochaetaceae Phlebiopsis
Organism Phlebiopsis gigantea    [TaxId: 82310 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PgigDyPrx03
start..stop
S start..stop
GluxDyPrx12 625 0 11..610 6..570
GluxDyPrx02 568 0 51..603 44..569
SbreDyPrx01 566 0 9..603 11..582
SlutDyPrx01 565 0 4..601 1..580
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 41602..41802 201 N° 2 41862..42478 617 N° 3 42530..42830 301 N° 4 42887..43139 253
N° 5 43204..43353 150 N° 6 43409..43719 311  
join(41602..41802,41862..42478,42530..42830,42887..43139,43204..43353,43409..437 19)


exon

Literature and cross-references PgigDyPrx03
DNA ref. JGI genome:   scaffold_67 (41602..43719)
Cluster/Prediction ref. JGI gene:   71660
Protein sequence: PgigDyPrx03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   610
PWM (Da):   %s   67349.97  
PI (pH):   %s   6.84
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTELDQHNFQHLSRRSIIPLLPPSFAKPPAVHEQRFLAEDDTALDAKVDDLPDLDNVQGDVIHLFPKKAEVFVFFRIADVAQFKTALRTFKVSSSNDVIQFLHTVGLEKRKAQGRKIGLIPKSFAQIAFTRMGMNFMNEREPTGDPRFDTHAMRDDREFLGDQAQWDKLFDKPHPDPVHGSANDDEGALHGVISVAGSGQNIILFSVSITQLILCVCVDSDNAKQAADAAKAHFGTAIVVRSDATINGQARPGDWAGHEHFGYQDGISQPALRGLSKPWPGQIVVDPGVIVMGYKGDPVLDDPYAPIKRPLWARDGTIMVFRKLEQFVPEFDDYLDRNGRRWKEFAPGGASCELTDKEGAELWGARMIGRWKSGAPVQRCPVRDDPAMGKDNNRNNDFDYHIRDDPKISPDVLTGYYCPFIAHTRKTVPRSLDPYIQRRFMDAAMIVRAGLPYGIEKKKAKKSDPDMRGLLFVSYQAGLDQGFVRQTTVFGNNDWFPTTSLIPSRHGQDTVIGGPPVPGSASDYTEVQFTGKPSALPKTGQEVNWTLVSKESGETISVTGFAGVKPTGAQPPPGVPQEFFVTSHGGEYFFVPSIKTLRMWANDGKTGGL

Retrieve as FASTA  
Remarks Complete sequence from genomic (5 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACCGAACTTGACCAGCACAACTTTCAACATCTATCCAGGCGTTCTATTATCCCTTTACTCCCGCCTTCCTTCGCGAAGCCTCCGGCTGTCCATGAGCAGCGCTTTCTTGCGGAAGAT
GACACCGCGCTCGACGCTAAAGTCGATGACCTCCCGGACCTAGACAACGTTCAAGGAGATGTGATCCACCTCTTTCCGAAG
GTGAGATTCAGACTTCATTGCGTTTTTGGCCCTGCCTGA
TTATTCTTGCCTCTTTATAGAAGGCCGAAGTCTTTGTCTTCTTCAGGATCGCCGATGTCGCGCAGTTCAAGACCGCTTTGCGGACGTTCAAAGTATCGTCCTCGAACGACGTGATCCAGT
TCCTTCACACAGTCGGGCTCGAGAAGCGGAAGGCGCAGGGAAGGAAGATTGGCCTGATCCCGAAGTCATTCGCTCAGATCGCGTTCACTCGTATGGGCATGAACTTCATGAACGAGCGAG
AGCCCACGGGCGACCCCCGGTTCGACACGCATGCGATGAGGGACGACAGAGAGTTTCTCGGCGACCAAGCGCAGTGGGACAAACTCTTTGACAAACCGCACCCCGATCCTGTCCATGGTT
CCGCTAACGACGATGAAGGCGCCTTGCACGGTGTCATTAGCGTCGCGGGCAGTGGTCAGAATATTATTCTCTTCTCGGTGTCTATAACCCAGCTGATTTTATGTGTTTGTGTAGATTCGG
ATAACGCGAAACAAGCCGCCGACGCCGCAAAAGCTCATTTTGGTACCGCGATAGTTGTCCGGTCTGACGCAACGATCAATGGCCAGGCCCGCCCGGGCGATTGGGCTGGGCATGAACACT
TTGGCTACCAAGATGGGATTTCCCAACCAGCCTTGAG
GTACGTAGTCCACATCAAGCTCATTTCTCTCGCTGACCTGTCGCGTCGTAGAGGTCTGTCCAAGCCATGGCCAGGTCAGATTG
TAGTTGACCCTGGTGTTATCGTCATGGGTTACAAGGGTGACCCCGTCCTCGACGACCCGTACGCACCTATCAAGCGTCCGTTGTGGGCTAGGGATGGGACCATCATGGTCTTCCGCAAAC
TCGAGCAGTTCGTACCCGAGTTCGATGACTATCTCGACAGGAACGGTCGCCGATGGAAGGAATTCGCGCCCGGGGGAGCGTCATGCGAGCTGACCGACAAGGAAGGCGCCGAGCTCTGGG
GTGCCCGTATGATCGGACGGTGGAAGTCT
GTGAGTAGTTGACTAGTAGATCTGCAATGTAATACCAGATCTCATATTCGCTACAGGGCGCACCCGTCCAGAGGTGTCCAGTGCGCGACGA
CCCCGCGATGGGCAAAGACAACAACCGAAACAACGACTTCGACTACCACATCCGAGATGATCCCAAGATCTCACCCGATGTTTTGACGGGTTACTACTGTCCTTTCATCGCACATACACG
CAAAACTGTACCTCGCAGCCTGGACCCCTACATCCAGCGCCGGTTCATGGATGCGGCGATGATCGTCCGCGCCGGCCTTCCATACGGCATCGAGGTAA
GTGAGGCTATCACGTTTTAGTC
CTTGCTGCTTATAAGTGCGATTGCTGTAGGTCACAGACAAAGAGAAGAAAGCTAAAAAATCCGACCCAGACATGCGCGGGCTCCTGTTTGTCTCTTACCAAGCCGGTCTCGATCAAGGTT
TCGTTCGACAAACCACTGTGTTTGGGAACAATGACTGGTTCCCAACGACATCCTTAATTCCCTCGAGACACG
GTACGCCATCGCCTCGGGGGTGAAACTAAACGACCGCTGACATTTATG
ATCATAGGCCAAGACACAGTAATCGGTGGCCCTCCTGTCCCAGGTTCCGCCTCGGATTACACCGAGGTGCAGTTCACCGGCAAGCCATCGGCGCTACCGAAAACAGGCCAGGAGGTCAAC
TGGACGCTCGTGTCGAAGGAGTCGGGCGAGACCATCTCGGTCACTGGATTTGCGGGTGTCAAGCCCACAGGCGCGCAGCCTCCGCCGGGCGTGCCGCAGGAGTTCTTCGTCACCTCGCAT
GGCGGCGAGTACTTCTTCGTCCCGTCGATCAAAACCTTGAGGATGTGGGCGAATGATGGCAAGACGGGAGGTTTGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACCGAACTTGACCAGCACAACTTTCAACATCTATCCAGGCGTTCTATTATCCCTTTACTCCCGCCTTCCTTCGCGAAGCCTCCGGCTGTCCATGAGCAGCGCTTTCTTGCGGAAGAT
GACACCGCGCTCGACGCTAAAGTCGATGACCTCCCGGACCTAGACAACGTTCAAGGAGATGTGATCCACCTCTTTCCGAAG
AAGGCCGAAGTCTTTGTCTTCTTCAGGATCGCCGATGTC
GCGCAGTTCAAGACCGCTTTGCGGACGTTCAAAGTATCGTCCTCGAACGACGTGATCCAGTTCCTTCACACAGTCGGGCTCGAGAAGCGGAAGGCGCAGGGAAGGAAGATTGGCCTGATC
CCGAAGTCATTCGCTCAGATCGCGTTCACTCGTATGGGCATGAACTTCATGAACGAGCGAGAGCCCACGGGCGACCCCCGGTTCGACACGCATGCGATGAGGGACGACAGAGAGTTTCTC
GGCGACCAAGCGCAGTGGGACAAACTCTTTGACAAACCGCACCCCGATCCTGTCCATGGTTCCGCTAACGACGATGAAGGCGCCTTGCACGGTGTCATTAGCGTCGCGGGCAGTGGTCAG
AATATTATTCTCTTCTCGGTGTCTATAACCCAGCTGATTTTATGTGTTTGTGTAGATTCGGATAACGCGAAACAAGCCGCCGACGCCGCAAAAGCTCATTTTGGTACCGCGATAGTTGTC
CGGTCTGACGCAACGATCAATGGCCAGGCCCGCCCGGGCGATTGGGCTGGGCATGAACACTTTGGCTACCAAGATGGGATTTCCCAACCAGCCTTGAG
AGGTCTGTCCAAGCCATGGCCA
GGTCAGATTGTAGTTGACCCTGGTGTTATCGTCATGGGTTACAAGGGTGACCCCGTCCTCGACGACCCGTACGCACCTATCAAGCGTCCGTTGTGGGCTAGGGATGGGACCATCATGGTC
TTCCGCAAACTCGAGCAGTTCGTACCCGAGTTCGATGACTATCTCGACAGGAACGGTCGCCGATGGAAGGAATTCGCGCCCGGGGGAGCGTCATGCGAGCTGACCGACAAGGAAGGCGCC
GAGCTCTGGGGTGCCCGTATGATCGGACGGTGGAAGTCT
GGCGCACCCGTCCAGAGGTGTCCAGTGCGCGACGACCCCGCGATGGGCAAAGACAACAACCGAAACAACGACTTCGACTAC
CACATCCGAGATGATCCCAAGATCTCACCCGATGTTTTGACGGGTTACTACTGTCCTTTCATCGCACATACACGCAAAACTGTACCTCGCAGCCTGGACCCCTACATCCAGCGCCGGTTC
ATGGATGCGGCGATGATCGTCCGCGCCGGCCTTCCATACGGCATCGAGGTAA
AGAAGAAAGCTAAAAAATCCGACCCAGACATGCGCGGGCTCCTGTTTGTCTCTTACCAAGCCGGTCTC
GATCAAGGTTTCGTTCGACAAACCACTGTGTTTGGGAACAATGACTGGTTCCCAACGACATCCTTAATTCCCTCGAGACACG
GCCAAGACACAGTAATCGGTGGCCCTCCTGTCCCAGGT
TCCGCCTCGGATTACACCGAGGTGCAGTTCACCGGCAAGCCATCGGCGCTACCGAAAACAGGCCAGGAGGTCAACTGGACGCTCGTGTCGAAGGAGTCGGGCGAGACCATCTCGGTCACT
GGATTTGCGGGTGTCAAGCCCACAGGCGCGCAGCCTCCGCCGGGCGTGCCGCAGGAGTTCTTCGTCACCTCGCATGGCGGCGAGTACTTCTTCGTCCCGTCGATCAAAACCTTGAGGATG
TGGGCGAATGATGGCAAGACGGGAGGTTTGTGA

Retrieve as FASTA