Entry information : PgigDyPrx04
Entry ID 10214
Creation 2012-01-27 (Christophe Dunand)
Last sequence changes 2012-01-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-27 (Catherine Mathe (Scipio))
Peroxidase information: PgigDyPrx04
Name PgigDyPrx04
Class DyP-type peroxidase D    [Orthogroup: DyPrxD003]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Phanerochaetaceae Phlebiopsis
Organism Phlebiopsis gigantea    [TaxId: 82310 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PgigDyPrx04
start..stop
S start..stop
PgigDyPrx 666 0 2..525 10..530
BaDyPrx07 498 2e-171 9..525 13..498
PplDyPrx01 481 9e-164 9..525 13..546
PplDyPrx02 404 7e-135 9..520 13..510
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 171744..171902 159 N° 2 171368..171683 316 N° 3 171156..171309 154 N° 4 170797..171103 307
N° 5 170514..170744 231 N° 6 170310..170460 151 N° 7 169991..170250 260  
complement(join(169991..170250,170310..170460,170514..170744,170797..171103,1711 56..171309,171368..171683,171744..171902))


exon

Literature and cross-references PgigDyPrx04
DNA ref. JGI genome:   scaffold_19 (171902..169991)
Cluster/Prediction ref. JGI gene:   85295|
Protein sequence: PgigDyPrx04
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   526
PWM (Da):   %s   58667.83  
PI (pH):   %s   6.59
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLTEELTSHICRRALLPLLSDVDCPIDDESVARKSPLPNPRNVQGDVYLTFSKDFENFLFFRFTNPTQFVQDLAHYKPTTSYDVMHDVMRKIAEAKAAGKRAKHWQSQVAFTREGLNILGHNEQIQDVDFDKVSTPSATSDEPFRTQIMHGVFIVAASDQEYLTNGVDEIMKIFGGSIVVSILEGHSRPKQERGHEHFGFMDGISQPALRGLVKPKKGQNQCDAGVIVMGYPGDPLYQDKHTPRPDWTRDGSIMVFRKLKQLVPEFRKYVADAGPKWREWMPAEDVPKIQPPLSDAEGAALFGARLFGRWKGAPIARAPFRDDPSQTAEDKANDFDYTVPGVFGPTQKLCPFTAHVRRTAPRNLDPFAAKSLLESALIVRGGIPYGDEVQPDEQETTKLDRGLLFVCYQSRIARGFLTQISWAFNDYFPVINFTPTKWGQDSIIGAAEPPPTLVQVRAVGGKIPDGDITLEVENNPPDANVVTVDGFAKPRLQPVVQPQFFVQVRGGDFFFVPSVSTLRLWSRG

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTCACGGAAGAACTCACATCACACATCTGCAGGCGGGCACTGCTCCCGTTGCTCTCAGATGTAGACTGCCCTATCGACGATGAAAGTGTAGCAAGGAAATCTCCGCTTCCTAACCCA
CGCAATGTTCAGGGAGATGTCTACTTAACATTCTCCAAG
GTAAACATACTGGGCTCTCATGTCATTAAATACGCTATACTGATTAATCGTATACAATAGGATTTCGAGAACTTCCTGTTC
TTCAGGTTCACCAACCCGACACAATTCGTCCAAGACCTGGCACACTACAAGCCGACGACGTCCTACGATGTCATGCACGACGTTATGCGGAAAATCGCCGAAGCCAAGGCAGCCGGCAAG
CGCGCGAAGCACTGGCAGTCCCAGGTCGCCTTCACTCGTGAAGGGTTAAATATCCTCGGGCATAATGAACAAATTCAAGATGTCGACTTCGATAAGGTTTCTACACCTAGCGCTACCTCC
GATGAGCCGTTCCGCACTCAGATCATGCACGGTGTTTTCATCGTGGCCGCTAGTG
GTAAGGACTCTGGACTATCTTCCATGGATCAATCATATTTGACCACCATGACTTCCAGACCAGGA
ATACCTTACGAACGGTGTAGACGAGATTATGAAGATTTTCGGTGGTTCTATTGTCGTCTCGATCCTCGAAGGTCACTCTCGTCCAAAGCAGGAGCGGGGTCATGAGCATTTTGGTTTTAT
GGACGGCATTTCACAACCCGCACTTCG
GTGAGAACGCTCGAGGCTTCGATCTGTCCATAGCTCTGACAGCCAACTGCAGGGGTCTGGTCAAGCCCAAGAAGGGCCAGAACCAGTGCGATG
CCGGAGTCATTGTCATGGGCTATCCTGGGGATCCTCTTTACCAAGACAAGCATACCCCAAGACCAGACTGGACTCGGGACGGCTCGATCATGGTTTTCCGCAAACTAAAGCAGCTGGTTC
CCGAGTTCAGGAAGTACGTTGCGGATGCGGGACCGAAATGGCGGGAGTGGATGCCGGCCGAAGATGTCCCCAAGATCCAGCCTCCCCTGTCCGACGCTGAGGGAGCAGCCCTATTCGGAG
CCCGTTTGTTTGGCCGCTGGAAGTCG
GTCAGTGCCCCAATTGCTCCATTGATGAATGTGCTGTGCTCATGAAATGTAGGGTGCGCCAATCGCCAGAGCGCCATTCCGCGACGATCCCTCC
CAGACCGCAGAGGACAAAGCCAACGACTTCGACTACACCGTTCCGGGCGTGTTCGGCCCCACGCAGAAGCTGTGCCCATTCACTGCTCACGTTCGGAGGACGGCTCCTCGAAACCTCGAT
CCATTTGCCGCAAAGTCGCTCCTCGAATCGGCTCTCATAGTTCGGGGCGGGATACCATATGGTGACGAA
GTAAACCTACGAGCTCTGTGCAGAAATAAAACATGTTGCTTACCGTCATGC
AGGTCCAACCTGACGAGCAGGAGACTACCAAGCTTGACCGCGGCTTGCTATTCGTGTGTTACCAATCGCGAATTGCCCGCGGCTTCTTGACCCAGATAAGCTGGGCCTTCAATGATTACT
TCCCTGTGATCAACTTCACCCCGACCAAGTGGG
GTACGTATTATGTTCCAGCTTGCTTAATGCTCGTTTAGATGTTCACCCCCATTCTATAGGACAAGACAGCATCATTGGTGCCGCCGA
GCCTCCACCGACACTTGTACAAGTGAGAGCGGTCGGGGGGAAGATCCCAGACGGCGACATCACACTGGAGGTCGAGAATAATCCTCCAGATGCCAACGTTGTGACCGTCGATGGCTTTGC
CAAGCCTAGGCTGCAACCGGTCGTCCAGCCGCAGTTCTTCGTTCAGGTCCGGGGAGGAGACTTCTTCTTTGTACCATCTGTCTCTACCCTGCGCTTGTGGTCGCGCGGATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTCACGGAAGAACTCACATCACACATCTGCAGGCGGGCACTGCTCCCGTTGCTCTCAGATGTAGACTGCCCTATCGACGATGAAAGTGTAGCAAGGAAATCTCCGCTTCCTAACCCA
CGCAATGTTCAGGGAGATGTCTACTTAACATTCTCCAAG
GATTTCGAGAACTTCCTGTTCTTCAGGTTCACCAACCCGACACAATTCGTCCAAGACCTGGCACACTACAAGCCGACGACG
TCCTACGATGTCATGCACGACGTTATGCGGAAAATCGCCGAAGCCAAGGCAGCCGGCAAGCGCGCGAAGCACTGGCAGTCCCAGGTCGCCTTCACTCGTGAAGGGTTAAATATCCTCGGG
CATAATGAACAAATTCAAGATGTCGACTTCGATAAGGTTTCTACACCTAGCGCTACCTCCGATGAGCCGTTCCGCACTCAGATCATGCACGGTGTTTTCATCGTGGCCGCTAGTG
ACCAG
GAATACCTTACGAACGGTGTAGACGAGATTATGAAGATTTTCGGTGGTTCTATTGTCGTCTCGATCCTCGAAGGTCACTCTCGTCCAAAGCAGGAGCGGGGTCATGAGCATTTTGGTTTT
ATGGACGGCATTTCACAACCCGCACTTCG
GGGTCTGGTCAAGCCCAAGAAGGGCCAGAACCAGTGCGATGCCGGAGTCATTGTCATGGGCTATCCTGGGGATCCTCTTTACCAAGACAAG
CATACCCCAAGACCAGACTGGACTCGGGACGGCTCGATCATGGTTTTCCGCAAACTAAAGCAGCTGGTTCCCGAGTTCAGGAAGTACGTTGCGGATGCGGGACCGAAATGGCGGGAGTGG
ATGCCGGCCGAAGATGTCCCCAAGATCCAGCCTCCCCTGTCCGACGCTGAGGGAGCAGCCCTATTCGGAGCCCGTTTGTTTGGCCGCTGGAAGTCG
GGTGCGCCAATCGCCAGAGCGCCA
TTCCGCGACGATCCCTCCCAGACCGCAGAGGACAAAGCCAACGACTTCGACTACACCGTTCCGGGCGTGTTCGGCCCCACGCAGAAGCTGTGCCCATTCACTGCTCACGTTCGGAGGACG
GCTCCTCGAAACCTCGATCCATTTGCCGCAAAGTCGCTCCTCGAATCGGCTCTCATAGTTCGGGGCGGGATACCATATGGTGACGAA
GTCCAACCTGACGAGCAGGAGACTACCAAGCTT
GACCGCGGCTTGCTATTCGTGTGTTACCAATCGCGAATTGCCCGCGGCTTCTTGACCCAGATAAGCTGGGCCTTCAATGATTACTTCCCTGTGATCAACTTCACCCCGACCAAGTGGG
GA
CAAGACAGCATCATTGGTGCCGCCGAGCCTCCACCGACACTTGTACAAGTGAGAGCGGTCGGGGGGAAGATCCCAGACGGCGACATCACACTGGAGGTCGAGAATAATCCTCCAGATGCC
AACGTTGTGACCGTCGATGGCTTTGCCAAGCCTAGGCTGCAACCGGTCGTCCAGCCGCAGTTCTTCGTTCAGGTCCGGGGAGGAGACTTCTTCTTTGTACCATCTGTCTCTACCCTGCGC
TTGTGGTCGCGCGGATAA

Retrieve as FASTA