Entry information : BbotDyPrx01
Entry ID 10215
Creation 2012-01-27 (Christophe Dunand)
Last sequence changes 2012-01-27 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-06 (Catherine Mathe (Scipio))
Peroxidase information: BbotDyPrx01
Name BbotDyPrx01
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Botryobasidiaceae Botryobasidium
Organism Botryobasidium botryosum    [TaxId: 264124 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BbotDyPrx01
start..stop
S start..stop
FmeDyPrx01 371 3e-125 6..477 1..468
FmeDyPrx03 371 5e-125 15..478 6..473
BaDyPrx02 371 1e-124 16..478 59..495
ShirDyPrx02 369 1e-123 6..477 1..485
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 163983..164059 77 N° 2 164114..164427 314 N° 3 164499..164674 176 N° 4 164736..165066 331
N° 5 165144..165270 127 N° 6 165333..165458 126 N° 7 165532..165599 68 N° 8 165664..165854 191
N° 9 165908..165937 30  
join(163983..164059,164114..164427,164499..164674,164736..165066,165144..165270, 165333..165458,165532..165599,165664..165854,165908..165937)


exon

Literature and cross-references BbotDyPrx01
DNA ref. JGI genome:   scaffold_48 (163983..165937)
Cluster/Prediction ref. JGI gene:   147513
Protein sequence: BbotDyPrx01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   479
PWM (Da):   %s   53765.43  
PI (pH):   %s   6.36
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAEIHLDTPDIPHPPLDLSNIQGDILRGFAKDTETFLFFRITDPAEFRSRLQHIIPLITTAKQCEEIRQKIQAFRHSKEYKPGERLPITELNVAFSARGLEVLGITDDLGDEEFKKGQYADAEDLGDVIEWDDIYTQTIHGVFLVASNSPSGIEMLIAKVQSSLGDSIETMAKVSGSVRPGDQRSHEFGFKDGISRPNIIGYTDPIYPGPKPILPGVILLGNVGDVQEINPPVHKERPAWAKDGSFLAFRHLQQLVPEYNRWLLKEATRLFPWIPSKGEVGSAAELLGARTFGRWKSGCPLSHSWHKDDPDIANDPQKNNNFDFGEDSGQTRLPFAAHIRKMMPRSNQPPDRLPFQQIVRAGIPYGPEVDKETEEESTVHDRGLLFVCYQSHLGNRRGFSFIQLWANDPKFPRIESSVPGLDLICGQKGDLDRTMTGLHQNQQERESIAPRFVVSKGGEYFFSPSLALREKFATS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGAGATCCATCTCGACACGCCAGACATACCACACCCACCCCTAGACCTCTCCAACATCCAAGGCGATATTCTGTCAGTGGTTCCATTGTGTGCACCGCGCTGGCTCTGCTTACTT
TTTTTTTGAAGGCGCGGCTTCGCGAAAGACACAGAAACGTTCCTTTTCTTTCGGATCACCGATCCTGCAGAGTTTCGCAGCCGACTTCAGCACATTATCCCCCTTATCACCACAGCCAAA
CAATGTGAGGAAATACGACAGAAGATTCAAGCATTTCGTCATTCCAAAGAATACAAACCCGGAGAACGTTTGCCTATCACTGAACTTAACGTCGCATTCTCCGCCAGAGGACTTGAAGTC
TTGGGTATTACGGATGATCTGGGCGATGAGGAATTCAAAAAAGGCCAATATGCCGACGCAGAAGATCTCGGGGATGTGATAAAAG
GTATACAAGTACGCTCAGTCTGCTGAGCCCTATAA
TTCACTAATACCATTCAATTGATCTACTTGATCTAGAATGGGACGACATTTACACACAAACAATTCACGGCGTCTTTCTGGTGGCTAGTAATTCTCCATCGGGAATTGAGATGTTAATTG
CAAAGGTACAGAGTAGCTTGGGGGATTCCATCGAGACAATGGCAAAAGTGAGCGGCTCAGTCAGACCTGGTGACCAGCGCAGCCATGAGCAT
GTAAGCAGCTGCTTCCGCCGCCTCGACT
GACTACTTACTATTAGTTACCCTCGTTCGATAGTTCGGATTTAAGGATGGGATTTCTCGGCCCAATATCATAGGCTATACTGATCCCATCTATCCCGGCCCTAAACCTATCCTTCCAGGG
GTGATACTCTTGGGAAACGTGGGTGATGTCCAAGAGATCAATCCGCCTGTCCACAAGGAGCGACCTGCGTGGGCGAAAGACGGATCCTTCCTCGCGTTCAGGCATCTCCAGCAACTCGTG
CCCGAATACAACCGATGGCTTTTGAAGGAGGCAACTAGGTTGTTTCCTTGGATACCGTCCAAAGGAGAAGTAGGGTCGGCAGCCGAGCTGCTGGGAGCACGAACGTTTGGTAGATGGAAA
AGTG
GTAAGGGATTGCTTAGTGTTGCGTTGGGAGTTCCCACTGGTTAACGTTTAACCTTCGTCCTTTCCCCTCTCGTGCAGGTTGCCCTCTATCTCACAGCTGGCACAAGGATGACCCAG
ATATCGCGAACGATCCCCAAAAGAACAATAACTTTGACTTCGGAGAAGACTCGGGGCAAACAAGGCTGCCTTTCGCAGCACACATCAG
GTCAGCCCGTAGACTCTTATTCGAACGAGTGG
TCATCCCGATGCTAATGAGCGTTATTGAAGGAAAATGATGCCGCGCTCCAATCAACCTCCGGACAGACTTCCATTCCAGCAGATCGTGCGTGCCGGTATCCCCTATGGGCCTGAGGTGGA
TAAGGAGACCGAGGAAGAGTCTACGGTCCACGACAG
GTAGATATATCTCTTCGTCTACCAGGACGGCCGCATTGTATTACCAACTACATTACTAACTACGGTAAAATAGAGGTTTACTGT
TTGTTTGCTATCAATCACATTTAGGCAACAGACGCGGGTTTTCATTCATCCAAAAAC
GTGCGTCATTCCTATTGTTGAGGTGCTCGCCTAGTGGATAAGTCTGACTGCCCCGACCGCTTA
GTCTGGGCCAATGATCCCAAATTCCCGCGCATAGAAAGTTCTGTCCCAGGCCTCGACCTTATCTGCGGCCAGAAAGGTGACCTGGACCGGACCATGACGGGTCTGCATCAGAACCAGCAA
GAACGTGAATCCATTGCCCCTCGTTTTGTCGTTTCGAAAGGCGGAGAATACTTTTTCTCCCCTTCCTTGAAG
GTGAGGAGCGTCCTTAGATATCGCAAGTGCAGATTTATGACGGATTCA
CATAGGCGCTTCGCGAGAAATTTGCTACCAGTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGAGATCCATCTCGACACGCCAGACATACCACACCCACCCCTAGACCTCTCCAACATCCAAGGCGATATTCTGCGCGGCTTCGCGAAAGACACAGAAACGTTCCTTTTCTTTCGG
ATCACCGATCCTGCAGAGTTTCGCAGCCGACTTCAGCACATTATCCCCCTTATCACCACAGCCAAACAATGTGAGGAAATACGACAGAAGATTCAAGCATTTCGTCATTCCAAAGAATAC
AAACCCGGAGAACGTTTGCCTATCACTGAACTTAACGTCGCATTCTCCGCCAGAGGACTTGAAGTCTTGGGTATTACGGATGATCTGGGCGATGAGGAATTCAAAAAAGGCCAATATGCC
GACGCAGAAGATCTCGGGGATGTGATAAAAG
AATGGGACGACATTTACACACAAACAATTCACGGCGTCTTTCTGGTGGCTAGTAATTCTCCATCGGGAATTGAGATGTTAATTGCAAAG
GTACAGAGTAGCTTGGGGGATTCCATCGAGACAATGGCAAAAGTGAGCGGCTCAGTCAGACCTGGTGACCAGCGCAGCCATGAGCAT
TTCGGATTTAAGGATGGGATTTCTCGGCCCAAT
ATCATAGGCTATACTGATCCCATCTATCCCGGCCCTAAACCTATCCTTCCAGGGGTGATACTCTTGGGAAACGTGGGTGATGTCCAAGAGATCAATCCGCCTGTCCACAAGGAGCGACCT
GCGTGGGCGAAAGACGGATCCTTCCTCGCGTTCAGGCATCTCCAGCAACTCGTGCCCGAATACAACCGATGGCTTTTGAAGGAGGCAACTAGGTTGTTTCCTTGGATACCGTCCAAAGGA
GAAGTAGGGTCGGCAGCCGAGCTGCTGGGAGCACGAACGTTTGGTAGATGGAAAAGTG
GTTGCCCTCTATCTCACAGCTGGCACAAGGATGACCCAGATATCGCGAACGATCCCCAAAAG
AACAATAACTTTGACTTCGGAGAAGACTCGGGGCAAACAAGGCTGCCTTTCGCAGCACACATCAG
GAAAATGATGCCGCGCTCCAATCAACCTCCGGACAGACTTCCATTCCAGCAGATC
GTGCGTGCCGGTATCCCCTATGGGCCTGAGGTGGATAAGGAGACCGAGGAAGAGTCTACGGTCCACGACAG
AGGTTTACTGTTTGTTTGCTATCAATCACATTTAGGCAACAGACGCGGG
TTTTCATTCATCCAAAAAC
TCTGGGCCAATGATCCCAAATTCCCGCGCATAGAAAGTTCTGTCCCAGGCCTCGACCTTATCTGCGGCCAGAAAGGTGACCTGGACCGGACCATGACGGGT
CTGCATCAGAACCAGCAAGAACGTGAATCCATTGCCCCTCGTTTTGTCGTTTCGAAAGGCGGAGAATACTTTTTCTCCCCTTCCTTGAAG
GCGCTTCGCGAGAAATTTGCTACCAGTTAG

Retrieve as FASTA