Entry information : OsPrx12
Entry ID 1022
Creation 2006-07-17 (Filippo Passardi)
Last sequence changes 2006-07-17 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-06-02 (Christophe Dunand)
Peroxidase information: OsPrx12
Name OsPrx12
Class Class III peroxidase    [Orthogroup: Prx088]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue types Callus
Flowers
Leaves
Pannicles
Roots
Stems
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx12
start..stop
S start..stop
OsiPrx12 704 0 1..346 1..346
HvPrx10 496 1e-178 3..322 9..330
SbPrx60 464 2e-165 7..332 21..354
BdiPrx62 464 2e-165 20..346 24..356
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 12440000..12440203 204 N° 2 12442998..12443432 435 N° 3 12443526..12443927 402  
join(12440000..12440203,12442998..12443432,12443526..12443927)


exon

Literature and cross-references OsPrx12
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q5U1T1   Q654S1   Q654S0 [Incorrect splicing]
DNA ref. GenBank:   NC_008394.1 (12482908..12486832)
Cluster/Prediction ref. UniGene:   Os.35123
Protein sequence: OsPrx12
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   346
PWM (Da):   %s   36343.03  
PI (pH):   %s   5.68
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGVAVAVAACALCLLPATTSGALRVGFYQSSCPNAEALVRQAVAAAFARDAGVAAGLIRLHFHDCFVRGCDASVLLTKNPAGGQTERDATPNNPSLRGFEVIDAAKAAVEAACPRTVSCADIIAFAARDSVKLTGNVDYQVPAGRRDGSVSNGTEALHNLPPPNATAQQLADTFFANKFLTLEDMVVLSGAHTVGRSFCASFFNRVWNGNTPIVDAGLDPAYAAQLRALCPTRDTLATTPMDPDTPATLDNNYYKLLPQGKGLFFSDNQLRVNATMNALVTRFAANEAEWKQRFADAMVKMGHIEVQTGRCGQIRVNCNVVNPSTSSPEVELAGEDQETGGAVAAS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, introns 1 and 3'), 4 mRNA and 35 ESTs. Two prediction for the PS (TREMBL). Containing IntR (3').
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCGTGGCCGTCGCCGTGGCGGCTTGCGCGCTGTGCCTCCTGCCGGCGACGACCAGCGGCGCGCTCCGCGTCGGGTTCTACCAGAGCAGCTGCCCCAACGCCGAGGCGCTCGTCCGC
CAGGCCGTCGCCGCGGCCTTCGCCAGGGACGCCGGCGTCGCCGCCGGCCTCATCCGCCTCCACTTCCACGACTGCTTCGTCAGG
GTACCTACTACTGAAACCCAGCTAGTGCATATAGTA
GTATAATGCAGAAATTATTGACCACCATCTCCATGAATATCTGTTTGTATAATGTTTATAGAAGCACATGCATATACGTATATGCCTGCAAAATGTCTGGCTTGCAAACGGGAAATAATC
GACTTATGTTTGATGTGCTTAACTTTTTTCTTAAGACAATGTTTAACTAAACACTTGAGAACAGCTAGCCCAGATTTTCCCAGTTGGGGAACCAAAATAAAACACTTATTTTGTTAATGA
TGATTAGTTTATCTACTTTTCACAAATTAATCCTGAAGATTTGAATTTTCTAATATGTTGGCGATCTGCATATTTGCCACATTATTAGAAACTGGATCGAGTAAACATCTACCCAACTAA
ACTTATTCAGGTCTATGCTCCATCTATGCATAGCTCATAAAAATACTTAAATTGGAAAAGAACTCAACAATTTTTCAAAATAGTTCTTTGCAAGTTAGTTTCCATGAATCCTTACATGTG
TGAGGATCAATATATGCACGGTGAAAATGGACTTGTAGGGGGCTTTTGACATCTCTCTCTAAATCTGTAATTGTCGTTTGTGTTGCTTTTCAATTAGTTTTACTAATTAATATCATGTCT
GCCTTGGGCCTTGGCTAGCTTATTTTTATGCTTCTCCGTTGCTAACTTGAGCTTAATTACCTCTTTTCAACCATGCATCCCTCAAGCGATCTACCAGCAGTATTGATTTTTTTCATTTAC
TTTTCGTCCCCAGAATGCATGAATTAAGCTATTAATTTAAGACTAAGACCACCAGCAAATATTCAAGTACTAGTATTTAGATTTTCCATAGAAAAGATATATTTGTCATCACACCAAATT
AAATTAAGAACTACACGCAAAAAAAAAGAACTTTGATTCCATTGTATATTTAACAAAATCTATCGATATACTTTTGAAAAAGATAATGCTCAAACATGTGTCTAAAAATGAAGACATTAA
AGAACAATTAAAGAGACCCTGGTCATGCTTAATGAAAACCAAAAAAAGGTAGAGTTGTCTCTGAAGACAAAGGGAACAAAGTAAAAAGCCATAAAAGAAAAGCTACCAAAATCAGAAAGC
ATAAGTGTATATAGTTACAGAATCAAAGCAGCTTTCTTTCTTTCAAGGGAACCGCATATACCCTGCTTGCAATGGGTGACAAACAAAAAGCCTCCCAGGCTCCCATTTGGCGAATCTCAG
TATGTTCCTTTCGTTTCCTCAATCCCCATTGATCCTTCATTTTTTCAGGTGTCGTATTAACATCCAGTACTGCTTGACACTGGCAGTCGTAAATATGTACTCCTTAGTTTGATAGTATCA
AAAATGGTATTTAACTCGTTGAATATCATATTTTGATGGAACAATAAGGTGTGATTTAGTTCAAGTCTTCAAGAGTATAATAAGGATGTGTTCGTTTGGCGACAGGAATGCTCCCTCTCG
GCACACAAAATAGAGCGGCGAAATAGCGCATGATTAATTAAATATTTACATAAACAAACTTAAAAAATAAATTAATATGATTTTTAAGCAACTTTTCTATAGAGAAAAGTTTTTGCGAAA
ACCGTTGAGCAGTCTAGAAAGTAGAAAGTATATGCACCGAAAATGAGGAGACAGAAGAAGTTGAGAAAATGTGGTATAGACTACAACTTAAGATGTACTTTAGTCTATGTAGAGCTAGGC
AACATATATATGACACAATAGGAGGTTAATGGCCGGAGTTTACAGCACGTGTATGTAGAGGAGTAATGTAGTTGACTATGTCACTAGGAGGTGGAAGAAGGGACGTGACATTGGATCTAA
CGATGCGAAACATGGACGGAGTCACAAATCAGGTTGGAGGAGCTTCTCGCTGAAACCAGAAATAAGCTAGGAGGTGGAGGAAGGGGTTGGTATGTTGTCCTTAATAAGAGCTAAAATCGA
TTGATTATTTGTTTTTTACAGCTATTTAAGGTTATAAACAAATAAATTAGCTATTAAAAAGTTGGAAAAATATTTTATAAATTTTCTAGTAGAAGATCGAGTAGGATAGAGGTGAAATGA
ATCTTCTAGTAATAATGCCTCAAAAAATTCTAGTCGACCTCACACAATAAAACAATAAGCATGTTAGTTAAACTGAGCATTACTAAAAACATATTAATTTGTTTGTTTGGATTACAATAA
AGACGTAGACATGTACACATAGCTATATTAGTTAAACCGGGTGTCATCAATTTACCTGTTGATTTGAATATATAGTTGTAAGCTTCTTCAGTACTCCCTCATTCCATAATATGTACTCCC
TTCATTCCATAATATAAGGTATAGTCAAACTTGGCACAGTCTATAATTTCTCATATACTATAAGGTTTAAACAAAATTATAACCATCTTAAAGTAAATTTAAATGTCAATCTAATGATAT
TAATTTTAGCAAATAAAATTTAATTTATATTATAATAATTGTTGGTCAAATGTTTTTATTTATGAATTTTGGAATATGTGCACACCTTATATTATGGGATAGATGGATTATATTTTTTAA
AATACTTCAGTAATCAGTCAGTGCTAGAATTTACACAAGCATGTACTACCTACATACTCTCTCCGTCCCATAAAAAATTAACCTAATATTGGATGTGACACATCCTAATACAATGAATTT
AGACATTGTACTAGATTCACTTTTTTCTGGGACGGATGGAGTACAAGATGAAACATTTTGAGTTACCTTTTTTTTTTCTTTTTTCTGAAAGAAATTCCTTCCTGTTACTGCAATGCAGGG
GTGTGATGCATCCGTCCTCCTGACCAAGAACCCCGCCGGTGGCCAGACGGAGCGCGACGCGACGCCGAACAACCCGAGCCTCCGGGGCTTCGAGGTGATCGACGCCGCCAAGGCCGCCGT
CGAGGCGGCGTGCCCGCGCACCGTCTCCTGCGCCGACATCATCGCGTTCGCCGCCCGCGACAGCGTCAAGCTAACCGGCAACGTCGACTACCAGGTCCCCGCCGGCCGCCGCGACGGCAG
CGTGTCCAACGGCACCGAGGCCCTCCACAACCTGCCCCCGCCCAACGCCACGGCGCAGCAGCTCGCCGACACGTTCTTCGCCAACAAGTTCCTCACCCTCGAAGACATGGTCGTCCTCTC
CGGCGCCCACACCGTCGGCCGCTCCTTCTGCGCCTCCTTCTTCAACCGCGTCTGGAACGGCAACACCCCCATA
GTACGTCGCCTCGCCGCGCCGCCGTCGTCCATGGCGCCCCCCATGCT
TTTTCGCAGTTACGCGGTGTGACGGTGCGTGCGCGTGTGTGTGCAGGTGGACGCCGGGCTGGACCCGGCGTACGCGGCGCAGCTGCGGGCGCTGTGCCCCACAAGGGACACGCTGGCGAC
GACGCCGATGGACCCGGACACGCCGGCGACGCTGGACAACAACTACTACAAGCTGCTGCCGCAGGGGAAGGGGCTCTTCTTCTCCGACAACCAGCTGCGGGTGAACGCCACCATGAACGC
GCTGGTGACCCGGTTCGCGGCGAACGAGGCGGAGTGGAAGCAGCGGTTCGCCGACGCCATGGTGAAGATGGGCCACATCGAGGTGCAGACCGGGCGGTGCGGCCAGATCAGGGTCAACTG
CAACGTCGTCAACCCGTCGACCTCCTCGCCGGAGGTCGAGCTGGCCGGCGAGGATCAGGAGACCGGAGGCGCCGTCGCGGCAAGCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCGTGGCCGTCGCCGTGGCGGCTTGCGCGCTGTGCCTCCTGCCGGCGACGACCAGCGGCGCGCTCCGCGTCGGGTTCTACCAGAGCAGCTGCCCCAACGCCGAGGCGCTCGTCCGC
CAGGCCGTCGCCGCGGCCTTCGCCAGGGACGCCGGCGTCGCCGCCGGCCTCATCCGCCTCCACTTCCACGACTGCTTCGTCAGG
GGGTGTGATGCATCCGTCCTCCTGACCAAGAACCCC
GCCGGTGGCCAGACGGAGCGCGACGCGACGCCGAACAACCCGAGCCTCCGGGGCTTCGAGGTGATCGACGCCGCCAAGGCCGCCGTCGAGGCGGCGTGCCCGCGCACCGTCTCCTGCGCC
GACATCATCGCGTTCGCCGCCCGCGACAGCGTCAAGCTAACCGGCAACGTCGACTACCAGGTCCCCGCCGGCCGCCGCGACGGCAGCGTGTCCAACGGCACCGAGGCCCTCCACAACCTG
CCCCCGCCCAACGCCACGGCGCAGCAGCTCGCCGACACGTTCTTCGCCAACAAGTTCCTCACCCTCGAAGACATGGTCGTCCTCTCCGGCGCCCACACCGTCGGCCGCTCCTTCTGCGCC
TCCTTCTTCAACCGCGTCTGGAACGGCAACACCCCCATA
GTGGACGCCGGGCTGGACCCGGCGTACGCGGCGCAGCTGCGGGCGCTGTGCCCCACAAGGGACACGCTGGCGACGACGCCG
ATGGACCCGGACACGCCGGCGACGCTGGACAACAACTACTACAAGCTGCTGCCGCAGGGGAAGGGGCTCTTCTTCTCCGACAACCAGCTGCGGGTGAACGCCACCATGAACGCGCTGGTG
ACCCGGTTCGCGGCGAACGAGGCGGAGTGGAAGCAGCGGTTCGCCGACGCCATGGTGAAGATGGGCCACATCGAGGTGCAGACCGGGCGGTGCGGCCAGATCAGGGTCAACTGCAACGTC
GTCAACCCGTCGACCTCCTCGCCGGAGGTCGAGCTGGCCGGCGAGGATCAGGAGACCGGAGGCGCCGTCGCGGCAAGCTAG

Retrieve as FASTA