Entry information : BaDyPrx02
Entry ID 10223
Creation 2012-01-31 (Christophe Dunand)
Last sequence changes 2012-01-31 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-01 (Catherine Mathe)
Peroxidase information: BaDyPrx02
Name BaDyPrx02
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Meruliaceae Bjerkandera
Organism Bjerkandera adusta    [TaxId: 5331 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BaDyPrx02
start..stop
S start..stop
BaDyPrx03 781 0 1..494 1..497
TcuDyPrx01 780 0 1..494 1..497
BaDyPrx06 763 0 1..494 1..497
BaDyPrx09 751 0 1..494 1..495
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 120419..120521 103 N° 2 120253..120355 103 N° 3 119863..120196 334 N° 4 119701..119815 115
N° 5 119076..119648 573 N° 6 118958..119024 67 N° 7 118715..118907 193  
complement(join(118715..118907,118958..119024,119076..119648,119701..119815,1198 63..120196,120253..120355,120419..120521))


exon

Literature and cross-references BaDyPrx02
DNA ref. JGI genome:   scaffold_20 (120521..118715)
Cluster/Prediction ref. JGI gene:   72268
Protein sequence: BaDyPrx02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   495 (479)
PWM (Da):   %s   52836.72 (51231.8)  
PI (pH):   %s   5.58 (5.39) Peptide Signal:   %s   cut: 17 range:17-495
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHLPLVVASVFALVGATHVAASSLGGRRTKSLLASFPGQAALPTLADVSAHNVTNGTFLPLQNIQGDILVGMKKQKERFVFFHVNDAAQFKSALKTYVPARITSTATLISDPAQQPLAFVNLAFSSAGLQALGITDNLGDQQFSSGQFADAENLGDDLREWVPPFTGTSIHGVFLIGSDDAFLDQYTDDISSAFGGSITQVRVLSGSARPGNQAGHEHFGFLDGISQPAVSGLVTKPFPGQAVVPPGIILTGRTGDTALRPSWALDGSFMAFRHFQQMVPEFNAYMLANAIQATSEGNLTQEQGAELLGARMFGRWKSGAPLDLAPTEDDPALGADPQRNNDFNYSDTLLDETRCPFGAHVRKTNPRADLPVQSLINHAIRSSIPYGPEMSNEEMASGVSIQDRGLLFAEYQSVIGNGFRFQQINWANNAKFPPFKPNTPGIEPIVGQGSPRTVGGLDPLNQTKTYTVPLFVIPKGGEYFFMPSISALTSTIAV

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCACCTACCGCTGGTCGTCGCATCAGTGTTTGCGCTTGTAGGGGCGACGCACGTCGCTGCTTCTAGCCTCGGTGGAAGGCGTACGAAGTCTCTTCTCGCCTGTGCGTTGTTTCTTTTG
ATTGATTGGTTCTTGCGGGATTTAAATCTGACTCTGTTTTCTTCAGCGTTCCCGGGGCAAGCTGCACTCCCAACCTTGGCGGACGTGTCAGCCCACAATGTGACCAACGGAACATTTTTG
CCCCTCCAGAACATTCAAGGCGACATTCT
GTACGCCGCAATTTCATACGTGGTTGTATTCGGGTCCGTTGCTGACGGTATTTCAGGGTTGGAATGAAGAAGCAAAAAGAACGCTTTGTCT
TCTTCCATGTTAACGACGCAGCACAGTTCAAGAGCGCGTTGAAGACCTACGTCCCTGCACGCATCACATCGACTGCGACCCTGATTTCGGACCCTGCCCAGCAACCGCTCGCTTTCGTAA
ATCTTGCGTTCTCAAGTGCAGGGCTCCAGGCGCTGGGAATCACGGACAACTTGGGGGATCAACAGTTCTCCTCTGGTCAGTTTGCGGACGCAGAAAACTTGGGGGACGATCTCAGGGAAT
GGGTACCACCTTTCACTGGCACTAGCATTCATGGCGTCTTTTTGATCGGAAGTGACCAG
GTGAGTCCAGCTAGAACTTGTCGAGAAACGTACTGATAGTCTAGTAGGATGCATTCCTCGA
CCAGTATACAGATGACATCTCCTCGGCGTTTGGAGGCTCCATCACCCAAGTGCGGGTGTTGAGCGGGTCTGCACGACCTGGAAACCAGGCGGGTCACGAAC
GTAGGTCGCCCATCGTGTC
TTATAACATGCTAGTCTCTGACGTTGCGCATAGACTTTGGCTTCCTCGATGGCATCTCCCAGCCGGCGGTTTCGGGCTTGGTAACAAAGCCATTTCCTGGCCAGGCAGTTGTGCCACCGG
GGATCATTCTCACAGGACGTACAGGCGACACCGCACTCCGTCCGTCATGGGCTCTTGACGGCAGCTTCATGGCGTTCCGGCATTTCCAGCAAATGGTCCCTGAGTTCAACGCCTACATGC
TTGCCAACGCCATCCAAGCGACCAGTGAAGGGAACCTCACGCAGGAGCAAGGTGCAGAACTGCTCGGAGCGCGCATGTTCGGTCGCTGGAAGAGCGGGGCACCGTTGGACCTCGCACCAA
CTGAGGATGACCCGGCGCTTGGCGCTGACCCGCAAAGAAACAACGACTTCAACTACTCGGACACGCTTTTGGATGAGACGCGGTGTCCCTTCGGCGCACATGTACGAAAAACGAATCCAC
GCGCGGATCTCCCTGTTCAATCCCTCATCAACCACGCTATACGATCGAGCATCCCATACGGACCGGAGATGTCCAATGAAGAGATGGCTTCGGGGGTAAGCATACAAGATCGGGGTCTTC
TTTTCG
GTATGGTCGTTCCACAAGCCGTCTTTGTAATTGGCTAAATTTTTGTTACAGCTGAGTACCAGTCTGTCATCGGCAACGGGTTCAGATTCCAACAGATCAACTGGGCAAATAATG
CGAA
GTCAGTGGTTTTAGAATGTTTTGTCTTTTCAGCTGCTGATGTTATTGCAGGTTCCCACCCTTCAAACCCAATACCCCTGGCATCGAGCCTATCGTTGGCCAAGGATCTCCGCGAAC
AGTGGGTGGGCTCGACCCCCTCAATCAGACGAAGACGTACACAGTCCCGTTATTCGTGATTCCAAAGGGAGGAGAATACTTCTTCATGCCCTCTATCTCTGCGCTCACTTCCACTATCGC
TGTTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCACCTACCGCTGGTCGTCGCATCAGTGTTTGCGCTTGTAGGGGCGACGCACGTCGCTGCTTCTAGCCTCGGTGGAAGGCGTACGAAGTCTCTTCTCGCCTCGTTCCCGGGGCAAGCT
GCACTCCCAACCTTGGCGGACGTGTCAGCCCACAATGTGACCAACGGAACATTTTTGCCCCTCCAGAACATTCAAGGCGACATTCT
GGTTGGAATGAAGAAGCAAAAAGAACGCTTTGTC
TTCTTCCATGTTAACGACGCAGCACAGTTCAAGAGCGCGTTGAAGACCTACGTCCCTGCACGCATCACATCGACTGCGACCCTGATTTCGGACCCTGCCCAGCAACCGCTCGCTTTCGTA
AATCTTGCGTTCTCAAGTGCAGGGCTCCAGGCGCTGGGAATCACGGACAACTTGGGGGATCAACAGTTCTCCTCTGGTCAGTTTGCGGACGCAGAAAACTTGGGGGACGATCTCAGGGAA
TGGGTACCACCTTTCACTGGCACTAGCATTCATGGCGTCTTTTTGATCGGAAGTGACCAG
GATGCATTCCTCGACCAGTATACAGATGACATCTCCTCGGCGTTTGGAGGCTCCATCACC
CAAGTGCGGGTGTTGAGCGGGTCTGCACGACCTGGAAACCAGGCGGGTCACGAAC
ACTTTGGCTTCCTCGATGGCATCTCCCAGCCGGCGGTTTCGGGCTTGGTAACAAAGCCATTTCCT
GGCCAGGCAGTTGTGCCACCGGGGATCATTCTCACAGGACGTACAGGCGACACCGCACTCCGTCCGTCATGGGCTCTTGACGGCAGCTTCATGGCGTTCCGGCATTTCCAGCAAATGGTC
CCTGAGTTCAACGCCTACATGCTTGCCAACGCCATCCAAGCGACCAGTGAAGGGAACCTCACGCAGGAGCAAGGTGCAGAACTGCTCGGAGCGCGCATGTTCGGTCGCTGGAAGAGCGGG
GCACCGTTGGACCTCGCACCAACTGAGGATGACCCGGCGCTTGGCGCTGACCCGCAAAGAAACAACGACTTCAACTACTCGGACACGCTTTTGGATGAGACGCGGTGTCCCTTCGGCGCA
CATGTACGAAAAACGAATCCACGCGCGGATCTCCCTGTTCAATCCCTCATCAACCACGCTATACGATCGAGCATCCCATACGGACCGGAGATGTCCAATGAAGAGATGGCTTCGGGGGTA
AGCATACAAGATCGGGGTCTTCTTTTCG
CTGAGTACCAGTCTGTCATCGGCAACGGGTTCAGATTCCAACAGATCAACTGGGCAAATAATGCGAAGTTCCCACCCTTCAAACCCAATACC
CCTGGCATCGAGCCTATCGTTGGCCAAGGATCTCCGCGAACAGTGGGTGGGCTCGACCCCCTCAATCAGACGAAGACGTACACAGTCCCGTTATTCGTGATTCCAAAGGGAGGAGAATAC
TTCTTCATGCCCTCTATCTCTGCGCTCACTTCCACTATCGCTGTTTGA

Retrieve as FASTA