Entry information : BaDyPrx04
Entry ID 10225
Creation 2012-01-31 (Christophe Dunand)
Last sequence changes 2012-01-31 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-01 (Catherine Mathe)
Peroxidase information: BaDyPrx04
Name BaDyPrx04
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Meruliaceae Bjerkandera
Organism Bjerkandera adusta    [TaxId: 5331 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BaDyPrx04
start..stop
S start..stop
BaDyPrx06 802 0 2..479 21..498
BaDyPrx01 707 0 1..479 20..497
BaDyPrx02 691 0 3..478 19..494
BaDyPrx03 666 0 1..478 20..497
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 106943..106956 14 N° 2 106845..106885 41 N° 3 106677..106779 103 N° 4 106288..106621 334
N° 5 106124..106238 115 N° 6 105499..106071 573 N° 7 105377..105443 67 N° 8 105128..105320 193
complement(join(105128..105320,105377..105443,105499..106071,106124..106238,1062 88..106621,106677..106779,106845..106885,106943..106956))


exon

Literature and cross-references BaDyPrx04
DNA ref. JGI genome:   scaffold_20 (106956..105128)
Cluster/Prediction ref. JGI gene:   184870
Protein sequence: BaDyPrx04
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   480
PWM (Da):   %s   51431.19  
PI (pH):   %s   6.75
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSVASATQKLSRTAPLLGAFPGQAALPTLSQFLGIKSKDDTFLPLENIQCDILVGMKKQKERFIFFHINDAAQFKAALKAFVPASITSTATLIAPAVQQPLAFVNIAFSCTGLRALGINDNLADAQFASGMFSDAKNLGDDIGQWQAPFTGTEIHGVFLIGTDQEEFLDQSSGDISSCFGASIAQLKVMSGSARPGDQAGHEHFGYLDGISQPAVTGWAVNVLPGQAVVPTGVIITGRLGDSHSRPAWAIDGSFMAFRHLQQKVPEFNAYTHAHAIRANGGGLLTKEQGAEYLGARMIGRWKSGAPLDLSPLHDNPALGADPTRNNLFNYASALVEESKCPFSAHIRKSNPRLDLPVLEVINHAVRSSIPYGPETSSAELESGVSSHDRGLLFVEYQSVIDKGFRFQQRIWCNDPLFPPGKPNIPGLDPIIGQGHPRTTRGLDPLAPHKTYTLPDFVVPKGGEYFFMPSISALTSTIAE*

Retrieve as FASTA  
Remarks Complete sequence from genomic (7 introns). Very short first exon confirmed with ESTs
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCGTTGCATCGTTCGTCACGTCTGTCTTTGCCTTTGTATACATCTAAACCTATGTTCCTGCTCCTAGTGCTACCCAAAAGCTATCGCGCACTGCGCCCCTCCTCGGCGGTATGTCA
TACGTTTGGTCCAGTCGGTCGTTTGTGCAGTTGCAACTCTGATCCTGTATCGTGCAGCGTTCCCTGGGCAGGCCGCGTTGCCCACCCTATCGCAATTTCTGGGCATTAAGTCCAAGGACG
ACACCTTTCTGCCGCTGGAGAATATTCAATGCGATATTCT
GTATGTCCTATCTTTCTTACGCGGTTGCATGGGGCTAACTTTGGCGGCCGCCAAGGGTCGGGATGAAGAAACAGAAGGAA
CGCTTCATCTTCTTCCATATCAACGACGCGGCCCAGTTCAAAGCTGCACTGAAGGCCTTCGTCCCAGCAAGCATCACATCTACGGCAACGCTGATTGCTCCTGCCGTACAGCAACCACTC
GCCTTCGTGAACATTGCGTTCTCGTGCACGGGGCTTCGCGCTCTCGGTATCAACGACAACCTTGCTGACGCGCAGTTCGCCTCCGGGATGTTTTCAGATGCTAAGAACCTCGGGGATGAC
ATCGGTCAGTGGCAAGCACCGTTCACTGGCACAGAGATACACGGCGTCTTCTTGATTGGAACCGACCAA
GTAAGTACCGCGGGACTTAGTAATGAGAATTGAACTCACCGTTGGGTAGGA
AGAGTTTCTGGATCAGTCTTCAGGTGATATCAGCTCGTGTTTCGGAGCCTCTATCGCCCAATTGAAGGTTATGAGTGGGTCTGCACGGCCTGGAGACCAGGCAGGACATGAAC
GTTAGTC
GTCATTAATCGTCTCCGACGTGCTGGTATCTAACATTGCGGGCAGACTTCGGCTACCTCGATGGCATATCTCAGCCAGCGGTTACGGGCTGGGCGGTGAACGTCCTTCCAGGTCAAGCAG
TCGTACCGACGGGTGTCATCATCACAGGCCGTCTTGGTGACTCTCACTCCCGCCCAGCATGGGCCATCGACGGGAGTTTCATGGCCTTCCGACACTTGCAGCAGAAGGTGCCCGAGTTCA
ACGCCTACACGCACGCGCACGCAATTCGGGCGAACGGTGGAGGACTCCTCACGAAGGAGCAAGGTGCAGAGTACCTCGGTGCCCGTATGATTGGCCGCTGGAAGAGCGGTGCCCCACTGG
ACCTTTCACCCCTCCACGACAACCCAGCTCTTGGCGCGGACCCCACGAGGAACAACCTCTTCAACTACGCGAGCGCGTTGGTGGAAGAATCGAAGTGCCCTTTCAGCGCGCATATCAGGA
AATCCAACCCACGCCTGGACTTGCCTGTCCTGGAGGTCATCAACCACGCCGTGAGGTCCAGCATTCCTTACGGCCCAGAAACGTCCAGCGCGGAGCTTGAGTCAGGAGTGAGCTCCCATG
ATCGCGGCCTCCTATTCG
GTATGTTTATGATTCAGCGAACACGCCAATATTGTTGGTTAAATGTCTGCTTCAGTTGAGTACCAGTCCGTCATCGACAAGGGGTTCCGGTTCCAACAGAGG
ATCTGGTGCAACGATCCACT
GTCAGTCCCTTCTTACTGTATTGCACCCCTCCTTGCCGCTGATGATACGCCTGTAGGTTCCCTCCCGGTAAGCCGAACATCCCCGGTCTCGACCCTATTA
TCGGTCAAGGACATCCGCGCACCACGCGTGGTCTCGATCCCTTGGCCCCGCACAAGACGTACACACTCCCGGATTTCGTGGTCCCGAAGGGTGGCGAATACTTCTTCATGCCGTCTATTT
CTGCGCTCACTTCCACTATCGCCGAGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCGTTGCATCTGCTACCCAAAAGCTATCGCGCACTGCGCCCCTCCTCGGCGCGTTCCCTGGGCAGGCCGCGTTGCCCACCCTATCGCAATTTCTGGGCATTAAGTCCAAGGACGAC
ACCTTTCTGCCGCTGGAGAATATTCAATGCGATATTCT
GGTCGGGATGAAGAAACAGAAGGAACGCTTCATCTTCTTCCATATCAACGACGCGGCCCAGTTCAAAGCTGCACTGAAGGCC
TTCGTCCCAGCAAGCATCACATCTACGGCAACGCTGATTGCTCCTGCCGTACAGCAACCACTCGCCTTCGTGAACATTGCGTTCTCGTGCACGGGGCTTCGCGCTCTCGGTATCAACGAC
AACCTTGCTGACGCGCAGTTCGCCTCCGGGATGTTTTCAGATGCTAAGAACCTCGGGGATGACATCGGTCAGTGGCAAGCACCGTTCACTGGCACAGAGATACACGGCGTCTTCTTGATT
GGAACCGACCAA
GAAGAGTTTCTGGATCAGTCTTCAGGTGATATCAGCTCGTGTTTCGGAGCCTCTATCGCCCAATTGAAGGTTATGAGTGGGTCTGCACGGCCTGGAGACCAGGCAGGA
CATGAAC
ACTTCGGCTACCTCGATGGCATATCTCAGCCAGCGGTTACGGGCTGGGCGGTGAACGTCCTTCCAGGTCAAGCAGTCGTACCGACGGGTGTCATCATCACAGGCCGTCTTGGT
GACTCTCACTCCCGCCCAGCATGGGCCATCGACGGGAGTTTCATGGCCTTCCGACACTTGCAGCAGAAGGTGCCCGAGTTCAACGCCTACACGCACGCGCACGCAATTCGGGCGAACGGT
GGAGGACTCCTCACGAAGGAGCAAGGTGCAGAGTACCTCGGTGCCCGTATGATTGGCCGCTGGAAGAGCGGTGCCCCACTGGACCTTTCACCCCTCCACGACAACCCAGCTCTTGGCGCG
GACCCCACGAGGAACAACCTCTTCAACTACGCGAGCGCGTTGGTGGAAGAATCGAAGTGCCCTTTCAGCGCGCATATCAGGAAATCCAACCCACGCCTGGACTTGCCTGTCCTGGAGGTC
ATCAACCACGCCGTGAGGTCCAGCATTCCTTACGGCCCAGAAACGTCCAGCGCGGAGCTTGAGTCAGGAGTGAGCTCCCATGATCGCGGCCTCCTATTCG
TTGAGTACCAGTCCGTCATC
GACAAGGGGTTCCGGTTCCAACAGAGGATCTGGTGCAACGATCCACT
GTTCCCTCCCGGTAAGCCGAACATCCCCGGTCTCGACCCTATTATCGGTCAAGGACATCCGCGCACCACGCGT
GGTCTCGATCCCTTGGCCCCGCACAAGACGTACACACTCCCGGATTTCGTGGTCCCGAAGGGTGGCGAATACTTCTTCATGCCGTCTATTTCTGCGCTCACTTCCACTATCGCCGAGTGA

Retrieve as FASTA