Entry information : BaDyPrx06
Entry ID 10227
Creation 2012-01-31 (Christophe Dunand)
Last sequence changes 2012-01-31 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-01 (Catherine Mathe)
Peroxidase information: BaDyPrx06
Name BaDyPrx06
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Meruliaceae Bjerkandera
Organism Bjerkandera adusta    [TaxId: 5331 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BaDyPrx06
start..stop
S start..stop
BaDyPrx04 802 0 21..498 2..479
BaDyPrx01 781 0 1..497 1..496
BaDyPrx02 763 0 1..497 1..494
TcuDyPrx01 715 0 1..497 1..497
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 94025..94136 112 N° 2 93860..93962 103 N° 3 93470..93803 334 N° 4 93302..93416 115
N° 5 92677..93249 573 N° 6 92556..92622 67 N° 7 92307..92499 193  
complement(join(92307..92499,92556..92622,92677..93249,93302..93416,93470..93803 ,93860..93962,94025..94136))


exon

Literature and cross-references BaDyPrx06
DNA ref. JGI genome:   scaffold_20 (94136..92307)
Cluster/Prediction ref. JGI gene:   172310
Protein sequence: BaDyPrx06
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   499 (476)
PWM (Da):   %s   53594.41 (51197.2)  
PI (pH):   %s   5.66 (5.22) Peptide Signal:   %s   cut: 23 range:23-498
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRLPLFVASAFAFIGASKYAAATSIVERQSRTAPLLGAFPGQAVLPSLAQILTFNATNGTFLPLENIQGDILIGMKKQKERFVFFQINDAAQFKTALKTYVPARITSTATLISPPDQQPLAFVNLAFSSTGFRTLGITDNLLDPQFSSGMFADAENLGDDPSQWAPPFTSTSIHGVFLIGTDDAFLDQYTDDISSAFGSSITQLKVMSGSARPGNQAGHEHFGYLDGISQPAITGWAMSVLPGQAVVPSGVILTGRVGDPIPRPAWAVDGSFMAFRHLQQKVPEFNAYTLANAIRVNAGGLLTQQQGAEFLGARMFGRWKSGAPLDLAPLHDDPALGADPLRNNLFNYGDALVDESRCPFSAHVRKTNPRLDLPVLEVINHGVRSSIPYGPETPSAELASGVSAQDRGLLFAEYQSVIDKGFRFQQRIWANDPLFPPGKPNVPGLDPVIGQGDPRDTRGLDPLNPLKTYTLPDFIVPKGGEYFFMPSISALTSTIAN

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGCCTTCCGCTATTCGTCGCGTCCGCCTTTGCCTTCATAGGCGCAAGCAAGTATGCTGCTGCTACCAGCATTGTTGAGAGGCAATCCCGCACTGCGCCTCTCCTGGGTGGTATGTTA
TTCCCTGGACTCGCCTAGCTAGTGTGCAATTGAAAACTGATTTGTGTCTTTAAGCGTTCCCCGGACAGGCCGTGCTGCCCAGCCTCGCGCAAATTTTGACCTTCAATGCGACAAATGGAA
CATTCTTGCCGCTGGAGAATATTCAAGGCGATATTTT
GTATGTCATAAATCCCGTGCTATAACGAGGAACCCAGGTCTGACGACTTCTCCAAGGATCGGGATGAAGAAACAGAAGGAACG
CTTCGTGTTTTTCCAGATCAACGACGCGGCCCAGTTCAAGACTGCGCTGAAGACCTACGTCCCAGCACGCATCACGTCTACCGCAACATTGATCTCGCCCCCCGATCAGCAACCACTTGC
TTTCGTAAACCTCGCATTTTCGAGCACGGGGTTTCGGACTCTCGGTATCACCGACAACCTCCTGGACCCGCAGTTCTCTTCGGGAATGTTTGCGGATGCAGAGAACCTCGGAGATGACCC
CAGCCAGTGGGCACCACCGTTCACAAGTACCAGTATTCACGGCGTCTTCTTGATTGGAACCGACCAA
GTGAGTCTCAGGCTGGTAATGGGGTATCGAAGATTGTACTGATTATTTGGTAG

GATGCATTCTTGGACCAGTACACGGACGATATCAGCTCAGCTTTCGGATCCTCAATCACTCAGCTGAAGGTGATGAGTGGATCCGCTCGACCCGGAAACCAGGCAGGACACGAAC
GTAGG
TTATCGACCGTCTCATATGACCCGTTGTCGTCTCACATTGCGGACAGACTTCGGCTACCTCGACGGCATATCTCAGCCAGCGATCACAGGCTGGGCGATGAGCGTCCTTCCGGGTCAAGC
AGTTGTACCATCGGGCGTCATCCTCACTGGCCGTGTCGGTGACCCGATCCCTCGCCCAGCATGGGCCGTCGATGGAAGTTTCATGGCCTTCCGGCACTTGCAGCAGAAGGTGCCCGAATT
CAACGCGTACACCCTCGCCAACGCCATTCGCGTGAACGCTGGCGGGCTCCTCACGCAGCAGCAAGGTGCAGAGTTCCTCGGCGCCCGCATGTTCGGCCGCTGGAAGAGCGGTGCCCCACT
GGACCTTGCACCCCTCCACGATGACCCGGCGCTCGGTGCGGACCCGCTGAGGAACAACCTGTTTAACTATGGGGATGCGTTGGTCGACGAGTCTAGGTGCCCGTTCAGTGCGCATGTTAG
GAAAACGAACCCGCGCTTGGACTTGCCTGTCTTGGAGGTCATCAACCACGGTGTGAGGTCCAGCATTCCCTACGGTCCGGAAACGCCCAGCGCAGAGCTTGCGTCCGGAGTAAGTGCTCA
AGATCGTGGCCTCCTCTTCG
GTATGCTCTTTATGTATAATAATTCCTTTCCTGTCGACTAAGTATCTATAACAGCCGAGTACCAGTCCGTCATTGACAAGGGGTTCAGGTTCCAACAGAG
GATTTGGGCCAATGACCCTCT
GTAAGTCTCTTCTCAGCGTTTTGTTCCCCTCCTTACGGCTGCTGATGCGCTATTAGCTTCCCTCCTGGCAAGCCAAACGTCCCTGGTCTTGACCCTGTT
ATCGGTCAGGGAGATCCGCGCGATACCCGTGGCCTCGATCCGCTCAACCCGCTCAAGACATACACACTCCCGGATTTCATTGTCCCGAAGGGTGGCGAATACTTCTTCATGCCCTCCATC
TCTGCTCTCACTTCCACCATCGCTAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGCCTTCCGCTATTCGTCGCGTCCGCCTTTGCCTTCATAGGCGCAAGCAAGTATGCTGCTGCTACCAGCATTGTTGAGAGGCAATCCCGCACTGCGCCTCTCCTGGGTGCGTTCCCC
GGACAGGCCGTGCTGCCCAGCCTCGCGCAAATTTTGACCTTCAATGCGACAAATGGAACATTCTTGCCGCTGGAGAATATTCAAGGCGATATTTT
GATCGGGATGAAGAAACAGAAGGAA
CGCTTCGTGTTTTTCCAGATCAACGACGCGGCCCAGTTCAAGACTGCGCTGAAGACCTACGTCCCAGCACGCATCACGTCTACCGCAACATTGATCTCGCCCCCCGATCAGCAACCACTT
GCTTTCGTAAACCTCGCATTTTCGAGCACGGGGTTTCGGACTCTCGGTATCACCGACAACCTCCTGGACCCGCAGTTCTCTTCGGGAATGTTTGCGGATGCAGAGAACCTCGGAGATGAC
CCCAGCCAGTGGGCACCACCGTTCACAAGTACCAGTATTCACGGCGTCTTCTTGATTGGAACCGACCAA
GATGCATTCTTGGACCAGTACACGGACGATATCAGCTCAGCTTTCGGATCC
TCAATCACTCAGCTGAAGGTGATGAGTGGATCCGCTCGACCCGGAAACCAGGCAGGACACGAAC
ACTTCGGCTACCTCGACGGCATATCTCAGCCAGCGATCACAGGCTGGGCGATGAGC
GTCCTTCCGGGTCAAGCAGTTGTACCATCGGGCGTCATCCTCACTGGCCGTGTCGGTGACCCGATCCCTCGCCCAGCATGGGCCGTCGATGGAAGTTTCATGGCCTTCCGGCACTTGCAG
CAGAAGGTGCCCGAATTCAACGCGTACACCCTCGCCAACGCCATTCGCGTGAACGCTGGCGGGCTCCTCACGCAGCAGCAAGGTGCAGAGTTCCTCGGCGCCCGCATGTTCGGCCGCTGG
AAGAGCGGTGCCCCACTGGACCTTGCACCCCTCCACGATGACCCGGCGCTCGGTGCGGACCCGCTGAGGAACAACCTGTTTAACTATGGGGATGCGTTGGTCGACGAGTCTAGGTGCCCG
TTCAGTGCGCATGTTAGGAAAACGAACCCGCGCTTGGACTTGCCTGTCTTGGAGGTCATCAACCACGGTGTGAGGTCCAGCATTCCCTACGGTCCGGAAACGCCCAGCGCAGAGCTTGCG
TCCGGAGTAAGTGCTCAAGATCGTGGCCTCCTCTTCG
CCGAGTACCAGTCCGTCATTGACAAGGGGTTCAGGTTCCAACAGAGGATTTGGGCCAATGACCCTCTCTTCCCTCCTGGCAAG
CCAAACGTCCCTGGTCTTGACCCTGTTATCGGTCAGGGAGATCCGCGCGATACCCGTGGCCTCGATCCGCTCAACCCGCTCAAGACATACACACTCCCGGATTTCATTGTCCCGAAGGGT
GGCGAATACTTCTTCATGCCCTCCATCTCTGCTCTCACTTCCACCATCGCTAACTGA

Retrieve as FASTA