Entry information : OsPrx13
Entry ID 1023
Creation 2005-07-19 (Filippo Passardi)
Last sequence changes 2005-07-19 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-06-02 (Christophe Dunand)
Peroxidase information: OsPrx13
Name OsPrx13
Class Class III peroxidase     [Orthogroup: Prx082]*
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue types Leaves
Seeds
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx13
start..stop
S start..stop
OsPrx14 465 7e-166 18..316 23..322
BdiPrx63 456 2e-162 19..324 22..329
OsiPrx12 455 5e-162 18..347 17..346
OsPrx12 455 6e-162 18..347 17..346
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..207 207 N° 2 8377..8793 417 N° 3 8896..9315 420  
join(1..207,8377..8793,8896..9315)


exon

Literature and cross-references OsPrx13
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q5U1T0
DNA ref. GenBank:   NC_008394.1 (12492502..12501813)
Protein sequence: OsPrx13
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   347
PWM (Da):   %s   36070.14 Transmb domain:   %s   i7-29o
PI (pH):   %s   4.96
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAMKCLLVFFLVAFFPGAAVSAGLKVGFYNETCPSAEALVQQAVAAAFKNNSGVAAGLIRLHFHDCFVRGCDASVLINGSTTERSAGPNASLRGFEVIDAAKAAVEAACPSTVSCADILAFAARDGIKLTGNVDYQVPAGRRDGNVSIAQDALDNLPPPTATAKELTDKFANKSLTLEDMVVLSGAHTVGRSFCSSFLDRIWNNTTAIVDTGLSPGYAALLRALCPSNANASTPITTAIDVSTPATLDNNYYKLLPLDLGLFFSDNQLRVNATMNALVTRFAANETEWKQRFADAMVKMGNIEVLTGGAGQIRLNCNVVNPSSSSSSPVVQLAGEEEAAAAGAVAAS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, introns 1 and 3') and 4 ESTs. Containing IntR (3').
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCATGAAGTGCCTCCTCGTCTTCTTCCTCGTCGCCTTCTTCCCCGGAGCCGCGGTCAGCGCCGGGCTGAAGGTCGGGTTCTACAACGAGACGTGCCCGTCGGCGGAGGCCCTGGTG
CAGCAGGCGGTGGCCGCCGCCTTCAAGAACAACAGCGGCGTCGCCGCCGGCCTCATCCGTCTGCACTTCCATGACTGCTTTGTCAGA
GTACGTTTGCATCTATCACGATCGATCCTAGTT
TCGTTTATAACTGCACTGTTTGGTGTAAGAACAGCTAGCTAACCTTGGTTGATTTTGTTTTCTTTGTTCAAAAAGGGAAACTATTTTAAACTCTCGAGATGGCATTCCCTCATTATTTGC
ATGTCATCCAAATGATTAAGAAAAAAAATCAACCAGGTATATTAATATGTGATAAATTATTCCACAAATATGCAAGGTCAAATTTAACTTCTATAAGTTTGAATGAAAAAAATAAATTTG
ATTAAGAATATTCGTTAACTAGCCATAGTTTATTTTTTTATAACCTGTAAAAGTTAAATTTTAACTTGCATATTTGTGGAGTGATTTATTATATATTAATCTATCTTGTTAAATTTTTTT
AAAAAAATTCATAACTATTTGGATAACATGTAAATAACTAGAGGATGTCCTCACGAGAGTTTAGAATCCACTCCCACACAAAAATGACAAACTCTAGCAGTGATAAAAAGAAAAGGTGTC
AATTTTTCATATTATAGACGCTGTGTTCGGCAAAAGGAGTTGGGAACCCACTCCCTCTTTTTCCACGCACACGCTTTTCAAACGGTTAAACGGTGTATTTTTTTTAAAAAAAATTCTATA
TGAAAGTTACTTTAAAAAATCATAAAATCATATTTATCTTTTTTTTTAAAAAAAATAGCTAATACTTAATTAATCACGTGTTAATAGACCGCTCCGTTTTCCTTGCGGGAGAGATTAGTT
CCCATCCCTGCTACTGAACACAGTTCAAGGGAGAGTTAGCTAAGATATATTTATGATCATATGTTATGAAAGATCGGCATATACGTACCGCTGTTTTTTTAAAAAAAACAGATCACCTGA
AGAAACATTAGTGCTCTCTATTACAATCACTGTGTTAGAAACAAAATACAACCATGAATCAAAAAAATAAAAGGAACAGAAGAAGGTATTACCATACTCCCTCCGTCCCAAAATATAAAG
AATTGGAGGGATATAACATAATATTCATACTAATAGGATATGTCATACCTCTCTAAAATCTCTAATATATATTAGAGTAGGTATAATAGGTAAATTTTTGCTGGCTATATTGGGTCCAAA
CTGAATAAAATACAGAGTTAGAGAAGAAATGAGTAGAAAGAGGGTCTGAGCGGGCGACTAATTACATACTAGTCGCCAGCTCCACACAGGCTCCAATTCAACAGTAGCAGCGCATGACCA
GTTTCGGTTGAGCTCCAGTAGCTGCTCACTTCTCAAGGAAAAATGAGTGTACAGGAAAGCTTCAAAAGAAGAAAAAGTATAATAAAAAAATTAAGAAGGGACATACTAATAGCTCTCTTA
TTGTACACATACCACAGTTATTAGTTAATTAAATACTAATATAGATATTTTTAGAGCCATCAGTCGGCTATATTATTAAACTTGCTCTTATGAGATATATTCCTAGTACTAGGATATGTC
ATATGCCTCCAAAATCTTTTATATTATAGAACGGAGGGAGTACCACTTAAGAAAACACAAGCAGCTTTGCCAATTTTGATTGTACCATCATAGTAGTTAATCACTATCATTTCAGAAAAG
CAAGCTCCATAAAAGATTGGTTCATTAATTTCCTGAGTTAAAAATCTGATACATTTCAGCATATTCCAATTTAGCCAGAAAGTAGTGGCCAAATTTAGAAGTTAATACTAATATCACACT
CCACTTCTCGAAGTCTCAGTTTTTCCAACAATATAAGCAGCTCCAGAGGGCAGGCAAGCACCATTCACCAAGCCTGCTGAATAAATTTAAATAATCTATATACTCTTTTGTAAGCATATA
TTTGTCATACATAGAGTATAGCTGTTGCTGCTTTACCAAATCACAGCTTCCACCTATGACAATGATGATTAGAAACAGCAGAGCCAGCCAGTTGAGGAACGTAATCACTATTCAGCAATA
GAAGTAAACCTGATCATAACTGTGATCAGATGCACGACAGCGGCGTCGTCGTCACTGACATGGATTGATAAGCAACTAGAGTCTTCCCTTTCGTTTGCCAACCCATGTGATTTTGGCCCC
ATAAATGCTGGGTCGGGTCGATGGGTCACTGGGTTGACCCAGCCCATGTGCATCCTAAGGCCTTATTTCTATTTAGTTTGGATGGAACTGAGGGAGATTGAATGAAAATAATTCCAGAAA
TGCTCAGGATCGGTCGATCGGAGGGAGGTTGAAAAATCGGTCGCTCTCTCTACCTCCCACGTGCGCACCCCACTGGACCTATCCACTTATCCCTCCCCTTTTTTAAAAAAAATGTTTCAC
CTAATGTATTTAGAATGTTTTATTATGTATAGATCTAATGTTGCAGTGAATTAAAATATTCTTATGCAACAAATTATCAATATATTTTGGAAACCCTCTATTAAGGGAATTCATTTCATT
TTTTTTCACCAAAAATGTTTCACCTAGTTTAATCACAATGTTTCACTATGTATAGATCTAATGTTGCAGTGAACGAAACATTTCTTCTGCAACAAATCACCCACATATTTTAGAAACCCT
CTATTAAGGTAATTCGTTTCAATTTTTGTTTCACAAAAATGTTTCACCTAGTGTACTCACAATATTTCACTATGTATAGATCTAATGTTGCAGTGAACTGAAACATTATTCGCTATTTGT
TGAAACATTGTTTTTATATAAGGTGAAACAATGCCCGATTTAATTGATTGAAACATTTTCGATATACTTAGAGAAACAATTCCAATATACTTGGTGGAACATCGTGCAATATTTAAAAAT
AGGCAAATTTTGCTACAGGACAACGTGACTTCGCGAGGACACCGCACGGAATGACTTTTGGGGGAATACACTCTATAAATGTGGTAATTTGCCAGGGGACACCGCACCCATTAAAATAAT
AATTTTCGCTTGAAGGAGAGAGAAAAATAGCGTGAAATGTCAAGAATAACCTTGGACCCACGTGTCAGCTCTCCCATCTCTCTCCATGTGTCAACTCTCCCATCTCTCTTCTCTTTGTCC
CCTCCTTCCTTCCCACGCTTCCCTGCGCCAGTCCGCAACCGCTCATCGATTCCTCACGCGCTCCAGCCCGCAGCCACCACCTCCCGCCGGACATCCGAGCGCCGTAGGTGGCTCCGGGTG
TACGCCCTACCCCACCGCCTCTGACCGCCGGACAGCCAGGCGCCGCCACTGGTTCAGGGCGCGCGCGCCTGCCGGACATCCGAGCACCGCTGCCTCCTCGACGCTGGTAAATTAATCGAG
ATTCGCTATAGATGTTTCTCTCTCGTGGCAAGAGGATGGATAATCAAACAGACGTCCAAAATTAATAGCTCATAGGCTGACCATGGACAGCTGGACCATGACGAGCTCACATGTGAGCTC
GAACACCTTGGCGGAGATGGCGAGCGCGCTCTTCTGTCCGTTCCGCGTCGCCTCGATGCTCACCTGGCAGTCCTTGGTCCACGCCATGAAGCTCACCATGCCGGCGATCTCCTCTAGCTT
GGCGATGATGTCGGCCACCGACGCGCCGGACACGAAGCGCATCCTCTCGCCACGCTCCTGGAACAGCCCGGACATGTCGAAGCTCGGCGACGATGCAATGATGTCGAACCCGTTTAGGAT
CTTGGGCCGCGGCATGCGCGGACACAGTCGTGGCAGTACGCCTCCCCGACGTGGCGTCCCCTGCCGGTGGGCGTGGTGCCGAGGTAGGCGCGCGGAACACGTTGTTGGTCAGGTCGGCGA
AGCGCGTCACCAGCTACCACCAGTGAGCCCTCCAGTGGCGCCACCCTGTCCGTATTGCCGACGAACCCATCTGTGGCATCGATGGAGGATATAGAGAGAGAAGAGAGATGGGAGAGCTGA
CATGTGGGTCTAGGGGTATTTCTGACATCTCACGTGGTTTTTCTCTCCTTCAAACGAAACCTATTATTTTAATGGGTGTGGTGTCTGCTGGCAAATTACCACGTTTATAGAGTGTATTCC
CCAAAAGTCATTTTGTGCAGTGTCCTACGGCTAAAACCGCGAAGTCACGATGTCCTGTAGCAAAATTTGCCTTAAAAATAATTCAATAATAAGCTAAAAAAAATTTCGTCGAAATATATC
CATGTGTGGTCTTGTTTTAAAGATTTAATTGCAACAAATTTAATTGTGCAATCGGATCATGATTTGGATAAATAATTTAAGAGAAAAATCAGTTTAAAGTGGTTTTGCATGTATGTGTGG
CGTCAGCGCCCAATTTTTCCCAATCTGGATTGGGTGCCCGACGCGTAGGCCTACAATCTATAGAGGTGAAAACGGATAGGATATTATCCGATCCGATCTAAATCCATCCGAAAATGAGGG
TATAGTATGGTTTCTTATAAATCCAACGGATATGGATACGGATTCGGATGCGGATATGATACCTTTAAAATTTGGCGGATGCGCCCATGTAACCACTCTATTTGTTGCATGTAACATGAG
CTGGCAAAATAGAGTGCTTAGAAATGCGAGTTCATAGATTTAATGTCACGTCCGGAAATTCACTAATAATTTCTGAATTAATTTGTGCATAAAATCCTCGTCCAGGAATCAGCCGAGGTA
CACAAACTGATAATTTAATATACAAATCCATCATAATAATAACGTTACATACTTACAAAAGAAAAGAAAAACAGTAGCGGAATTAACGGTCTAGCGATGGCTTCAGCTCCACTCCCACAG
GCAACTCAACTGGGGAATAAGCCAAACGTCTTCTCCTTCTGGATCCTTTTTCTTCAACTGAGGTTGATTGATTATTGCAAGAATGAGCATATGACATACTCAACAAGCTACACAGCAAAT
ATGCAAGTGCACAAGGATACCAAAGGATAGCATAATATAGTCTCATTTGCGAAAGCAACATTTAGCAAAGAGTTAAAAGTAGTAAAACAGTAGAGTAATTAATCAGAAATTTTAATCAAC
ACTGAACAGCACACCCATGCTGCACAGGCCCAACCATCCTGAACAACCATACCCGGCTGTACAGATTTAACTCTAAACCAGGAGCTAAACAAATTATTACCAGTTATAGCATCATTTATT
ATGGTGAGAAGTGTGAGACTAATCACGAAAGACATTGTTCGACCCCCCCATGACCGCGGGCACGGCTATTCGAATAGTTTTACTCTGACCAGAGGTGTACCACTGTACCCACAAGACACA
ACCCACCGTCATGTACTCATGTCACCGTGTCCGCGCAGACACGTCACCATGACGAGTGATTGTGACAAGACCCCTCGCATAACTCAACCCAAAGCAGTGCACCGTTCCTGGATCATAATC
ACCCCCTTATAAACAAGGCATGGACTCCCCAGCGACCCCCGTGGGCTTATCTCCGCCACTTCTCAGTCTGGTGCTCCGCAAAGAGCCTTGTTATACAAAGTGTCCAGGCGTTGCCCATTC
TGGCTTGTGGTTGGCACGGTTAATGTTTCACAACCGAAAATCATGAACCGGTCCTTAATTGTCACGAGCACTACCATCAAAACCATGTGCTCACAACCCACCATTATCAAGTTTTAGTTG
GCACATTAATTAATTAACCAATCACGATTAACCATCGTGAGCTATCATTAAATATCCATCATTAAGTAATAGTGAAACATTAGTTATCCCAATTGTGTGCTAATGTTTTTAAGCATGGCT
ATGCAATGATATCTAACATCTAGCTGAACCAATATATAAAGCTCAACTAGTCAAATTATAATAACCCAAGGTAATCAAGAAATAGGGTAATCAATGCAAATGGGCCATAACAAAGGAACA
TGTTCACACCACCCGGTGACATTCAAAAATAAATACACAGTTGAAATAAATAGAGAATTTAAATATAGGATCAACATGCTCAAAGGAATGGTGTTTAGGATCTGTGTGACTTGCCTTGCA
ATAACGGGTCTTCAATTAATCTTCTTGAACACTTCCGGCGCACTCGCGAACCTTCGAAACGACGGAAACGACAAGCTAACACGCAAAAAGAGGAAAAAGACTAATAAAAACCAAATAAAC
AATACATATAAAGTAAACAAACATGTAGAAAATAATTTTAGAGGAATTATGAGACTTGAACGGCCTCATTCTGACTTCATATGAATTTATTACGAATTTTACAAGATTAAATCTAATTAA
AGCCTATTTAAAAAGGATTAAATAAATTTAATTCAATTTATGGATAATTTTAATATGTAGATCTTTATTTTATACAACTTTTGCAACTGGAACCACATTAAACTGAGTTACGACGAATTA
GTTATGAATTTTTAAAGATTAAACCGGATTAAAGCATTTATATGGATTTTAATTGAATTATGACGCAATAATGAATTATTTTTAAAAAGGAAAAGGGAATTATTGCGTCATCGGCTAGGG
TTCGCGGTGGACCGGGTGCACGACTGCGGCTCACGGAACGAACGGCCGAGATCATCTTGATCTACCGCGGTCCACGGGGAATGACATCGATGACGTCGGCGATGACGTCATCACCGGCGA
CGACCGGACGGCGCAAGCTCGCCGGCGAACTACGGCACGACAATGCTAACGAAGGGCACCAAAATGATGCGGGCGACGCGGCGAACTCACCGGTGACCAAAACAACGGCGGAAGATCAAC
GGACGGCGTCAGCGACGAGGAAGAAGCGGCGACGACCTTCGGCTTGACGACGACGGCGGTGCTCCAGCGATCTTCGGCGGAAACGGAGGGGTGGACGAGATCGGCGACGGCTTGGCGACC
ATGACGGTGACCTCCCCGAGCGACGACGACGACTGGAGCGACGACAACGCATGGCTGAACGAACAACGGCGACGGCGGTGCTAAGCGGCACGGTGCTAGAGCTCTACCGGCGACGAGAGA
CGAAGGCGAGGGTGGCGGCGGGTAGAGGAGGGCCTGGGGAACCTTTTATAGAGGCTAGGAGGCGGCGGCGAAGGCCCACGGCGACCGGCGACGCGAAGGAAAGGTTAGGGTTCGGGAGAG
AGAGAGGAATCCGATTCGAGATCGAATCCGGCACTTTCCAAGCGATTTTAGCCGATGATACCAAAAGAGGAAAGATAGAGAAGATCTCGGGAAACATTTCCCCTCAAACGATTTCACCGG
AGAAGGAAAGGCGCGGCCGAATTTGGAAGGAAACGGCGGCGGAGCAGCTAGGGTTTCGGCGCGGCGGCGGAGTGAGGTTGACGACGAGCCAGACAAGTGGGTCCCGCCTGTCAATGAAAG
GAAGAGAGGAGGGAGAGGTGGCGGACTGGGCCGGCTTGGGCCGAGCACGCGCAGGCCGAGGAGAGGGAGAGAGACAGACTTGGGCTGACTTTCGGCCCAAAGCCAAAAGAGGATTTTAAA
AACCTTTTTCCATTTAAATTATTCATGAAATGCAATTACATTGATTAAAAATACTTCCTTGGCTCAAATAAATCCCAGAAAAATCTAGGAACTATAGAAACAAAAGAAGTATTTAACAAA
ATTTTATCTAGCCCACTTTTATATTGAGATTTAACAAATTAAAATTAGATCTTCTCTTTTAGGCTTTTAAGATCATTTCTAATAATTCCTTTTAGACAACAATTTATAATTTAAGGATTT
TTAAACAAGAAAAACACTTAACATAATTATAATTAGATCATTAAATGATTAACTAATTACTGAATTGTTCTTTGTATTATTAAAATTAGGAATTGAGCTCTGAAAAATCCGAGAAAATCT
CAGAGAGTATAATTAATCATGGAGAATTTAATAAAAATTAAATCCATCCATGCTTTAAATTTAGGAAATTTTATTTCCCACATTTAAATTTACTTGTAAATTAATGAACATTTAATATAA
ATTCTTTTAATAATTTATTAAATTGTTTATAAATCCTGAAACAAAAATCAGGCTGTGACATTTAAACACCAGTAGTATATCCAAGCAATATAGTGGTTACCCGAAGACTATTTTGCCTGG
ATATTTGTAAAGAGTTCACAACAGAGATATGCTACGTGTTTGGATCCATTTTACCAAAAAAGTAGTTCAAAACGGTAAAACTTTTGCTATTTTGAAGGATCTAAACATGCCCGAAATGGT
AAAGAGAAATAGGAAAAATATTCGTGAGATGCAACATTTCTATTATTTAAAAGAAAAGAAAGAAGAGAATTCTCAATTTCTGCCCAATGTCTGCAGGGCTGCGACGCCTCAGTTTTGATC
AACGGGAGCACCACCGAGAGAAGCGCCGGCCCCAACGCGAGCCTCCGGGGCTTCGAGGTGATCGACGCCGCCAAGGCCGCCGTCGAGGCCGCGTGCCCGAGCACCGTCTCCTGTGCCGAC
ATCCTCGCCTTCGCCGCCCGCGACGGCATCAAGCTCACCGGCAATGTCGACTACCAGGTCCCCGCCGGCCGCCGCGATGGCAACGTCTCCATCGCCCAGGACGCCCTCGACAACCTGCCC
CCACCCACCGCCACGGCGAAGGAGCTCACCGACAAGTTCGCCAACAAGTCCCTCACCCTCGAGGACATGGTCGTCCTCTCCGGCGCCCACACCGTCGGCCGCTCCTTCTGCTCCTCCTTC
CTCGACCGCATCTGGAACAACACCACCGCCATC
GTACGTACATAGCTCGCCGGCGACGGCGAACTCTATCGATCGCCATTTGACCATTTCGCCATTGACGGCTCACATGGCGGCGGCCGG
TGTGTTCGTGTGCAGGTGGACACGGGGCTGAGCCCGGGGTACGCGGCGCTTCTGAGGGCGCTGTGCCCGTCGAACGCGAACGCGTCGACGCCGATCACGACGGCGATCGACGTGAGCACG
CCGGCGACGCTGGACAACAACTACTACAAGCTGCTGCCGCTCGACCTGGGGCTCTTCTTCTCCGACAACCAGCTGCGGGTGAACGCGACGATGAACGCGCTGGTGACACGGTTCGCGGCG
AACGAAACGGAGTGGAAGCAGCGTTTCGCCGACGCCATGGTGAAGATGGGCAACATAGAGGTGCTGACTGGGGGAGCCGGCCAGATCAGGCTCAACTGCAACGTCGTCAACCCTTCGTCG
TCGTCCTCGTCGCCGGTGGTCCAGCTGGCCGGCGAGGAGGAGGCCGCCGCCGCCGGCGCCGTCGCGGCGAGCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCATGAAGTGCCTCCTCGTCTTCTTCCTCGTCGCCTTCTTCCCCGGAGCCGCGGTCAGCGCCGGGCTGAAGGTCGGGTTCTACAACGAGACGTGCCCGTCGGCGGAGGCCCTGGTG
CAGCAGGCGGTGGCCGCCGCCTTCAAGAACAACAGCGGCGTCGCCGCCGGCCTCATCCGTCTGCACTTCCATGACTGCTTTGTCAGA
GGCTGCGACGCCTCAGTTTTGATCAACGGGAGC
ACCACCGAGAGAAGCGCCGGCCCCAACGCGAGCCTCCGGGGCTTCGAGGTGATCGACGCCGCCAAGGCCGCCGTCGAGGCCGCGTGCCCGAGCACCGTCTCCTGTGCCGACATCCTCGCC
TTCGCCGCCCGCGACGGCATCAAGCTCACCGGCAATGTCGACTACCAGGTCCCCGCCGGCCGCCGCGATGGCAACGTCTCCATCGCCCAGGACGCCCTCGACAACCTGCCCCCACCCACC
GCCACGGCGAAGGAGCTCACCGACAAGTTCGCCAACAAGTCCCTCACCCTCGAGGACATGGTCGTCCTCTCCGGCGCCCACACCGTCGGCCGCTCCTTCTGCTCCTCCTTCCTCGACCGC
ATCTGGAACAACACCACCGCCATC
GTGGACACGGGGCTGAGCCCGGGGTACGCGGCGCTTCTGAGGGCGCTGTGCCCGTCGAACGCGAACGCGTCGACGCCGATCACGACGGCGATCGAC
GTGAGCACGCCGGCGACGCTGGACAACAACTACTACAAGCTGCTGCCGCTCGACCTGGGGCTCTTCTTCTCCGACAACCAGCTGCGGGTGAACGCGACGATGAACGCGCTGGTGACACGG
TTCGCGGCGAACGAAACGGAGTGGAAGCAGCGTTTCGCCGACGCCATGGTGAAGATGGGCAACATAGAGGTGCTGACTGGGGGAGCCGGCCAGATCAGGCTCAACTGCAACGTCGTCAAC
CCTTCGTCGTCGTCCTCGTCGCCGGTGGTCCAGCTGGCCGGCGAGGAGGAGGCCGCCGCCGCCGGCGCCGTCGCGGCGAGCTAG

Retrieve as FASTA