Entry information : BaDyPrx09
Entry ID 10230
Creation 2012-01-31 (Christophe Dunand)
Last sequence changes 2012-01-31 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-01 (Catherine Mathe)
Peroxidase information: BaDyPrx09
Name BaDyPrx09
Class DyP-type peroxidase D    [Orthogroup: DyPrxD001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Meruliaceae Bjerkandera
Organism Bjerkandera adusta    [TaxId: 5331 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BaDyPrx09
start..stop
S start..stop
TcuDyPrx01 900 0 1..496 1..498
BaDyPrx03 899 0 1..496 1..498
BaDyPrx11 874 0 1..495 1..496
BaDyPrx02 751 0 1..495 1..494
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 141364..141475 112 N° 2 141533..141629 97 N° 3 141683..142016 334 N° 4 142070..142184 115
N° 5 142240..142812 573 N° 6 142864..142930 67 N° 7 142986..143178 193  
join(141364..141475,141533..141629,141683..142016,142070..142184,142240..142812, 142864..142930,142986..143178)


exon

Literature and cross-references BaDyPrx09
DNA ref. JGI genome:   scaffold_20 (141364..143178)
Cluster/Prediction ref. JGI gene:   287732
Protein sequence: BaDyPrx09
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   497 (474)
PWM (Da):   %s   53005.61 (50646.3)  
PI (pH):   %s   4.97 (4.79) Peptide Signal:   %s   cut: 23 range:23-496
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRLSLFVVSVAVFIGSSTHVSAAKLGARQSRTTPLLTNFPGQAPLPSLEQHSTQRGANTLPLDNIQGDILVGMKKQKERFVFFHVNDATSFKTALKTYVPDHITSAQTLISDPSEQPLAFVNLAFSNTGLQALGVTDSLGDAQFPNGQFADASNLGDDLSQWVAPFTGTTIHGVFLIGSDQDSFLDQFENDISTAFGASITEVQALSGSARPGNLAGHEHFGFLDGISQPAVTGWETTVRPGQAVVPPGIILTGRDGDPTTRPSWALDGSFMAFRHFQQKVPEFNAYTLANAIPANSAGNLTQQEGAEFLGARMFGRWKSGAPIDLAPTADDPALGADPQRNNNFDFSDTLTDETKCPFAAHIRKTNPRQDLGGPVNTFHAIRSSIPYGPETSDAELASGVTSQDRGLLFVEYQSVIGNGFRFQQINWVNNAGFPFSKPIAPGIDPIIGQSPTRSTGGLDPLDQTKTFSVPLFVIPKGGEYFFMPSISALTSTIAA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (6 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGTCTTTCGCTGTTTGTCGTGTCGGTCGCTGTATTCATCGGGTCGAGCACCCATGTCTCTGCTGCTAAACTCGGTGCGAGGCAGTCGCGCACAACGCCTCTCCTCACCAGTATGTCG
TCTTGTTGTCCCACTGGCATTGTGTCATGTCTAACCTCGCATATTCTAGACTTCCCGGGACAGGCCCCGCTGCCTTCCCTAGAGCAACACTCGACTCAGAGGGGTGCCAACACCCTCCCT
CTGGATAACATCCAGGGCGACATCTT
GTACGTCCTTTCGCACTCCGTCGCATCTAGACCAATCACTAACAATAATCTAGGGTTGGAATGAAGAAACAGAAGGAACGCTTCGTCTTTTTCC
ACGTCAATGACGCGACCTCGTTCAAGACGGCGTTGAAGACATACGTGCCTGACCACATCACGTCGGCCCAGACCTTGATTTCAGATCCCTCTGAGCAGCCGCTGGCCTTCGTCAACCTTG
CGTTCTCGAACACAGGGCTTCAGGCGCTCGGAGTCACTGACAGTCTGGGCGACGCGCAATTCCCCAACGGCCAGTTCGCCGACGCGTCAAACCTCGGAGACGACCTTAGCCAATGGGTGG
CGCCTTTCACTGGCACCACTATCCATGGTGTTTTCTTGATTGGTAGTGATCAG
GTGAGTCTGATCAGGGCATGTTGAGAATCGTATTGATACTAATTGTTCATTAGGATTCCTTCCTGGA
TCAGTTTGAGAACGATATCTCCACCGCTTTCGGTGCCTCGATCACCGAAGTACAGGCGCTGAGCGGGTCTGCTCGTCCAGGAAACCTGGCGGGCCATGAAC
GTAAGCTTCTCTGCATTTT
ACGCAGCTCAACGAGGGAGTCTAACACTGTACGCAGACTTCGGTTTCCTCGACGGCATCTCGCAGCCCGCAGTCACGGGTTGGGAGACGACTGTCAGGCCAGGCCAGGCAGTTGTCCCAC
CAGGCATCATCCTCACCGGACGTGACGGCGACCCAACCACTCGTCCTTCATGGGCTCTCGACGGCAGTTTCATGGCGTTCCGCCACTTCCAGCAGAAGGTCCCTGAGTTCAACGCCTACA
CGCTGGCCAATGCTATCCCGGCCAATAGTGCAGGAAACCTCACCCAGCAGGAGGGTGCCGAGTTCCTCGGTGCACGTATGTTTGGTCGCTGGAAGAGCGGCGCGCCCATCGACCTCGCGC
CCACTGCGGACGATCCCGCGCTCGGTGCTGACCCTCAAAGGAACAACAACTTCGATTTCTCGGATACCCTAACGGACGAGACGAAGTGCCCCTTCGCTGCGCACATCAGGAAGACAAACC
CCCGTCAGGACTTGGGTGGCCCAGTAAACACCTTCCATGCTATCCGCTCCAGTATTCCCTACGGCCCGGAGACGTCTGACGCTGAGCTTGCTTCAGGCGTGACTTCGCAAGATCGTGGTC
TTCTCTTCG
GTATGCTCCGTCTGAGTACTCTTCATTACAATCAGCTAATTTCCGCCATAGTCGAGTACCAATCCGTCATCGGCAACGGCTTCAGGTTCCAACAGATCAACTGGGTTAACA
ATGCAGG
GTGAGTACTTTGTGACGTTTGATCCGGTTATTACAGCTGCTGATGGCCCTTACAGGTTCCCATTCTCCAAGCCAATCGCGCCCGGTATTGACCCCATCATCGGTCAGTCGCCT
ACACGCTCGACGGGTGGCCTCGACCCTCTCGACCAGACGAAGACGTTCAGTGTCCCGCTGTTCGTGATCCCGAAGGGTGGAGAGTACTTCTTCATGCCCTCCATCTCTGCGCTCACCTCC
ACTATCGCGGCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGTCTTTCGCTGTTTGTCGTGTCGGTCGCTGTATTCATCGGGTCGAGCACCCATGTCTCTGCTGCTAAACTCGGTGCGAGGCAGTCGCGCACAACGCCTCTCCTCACCAACTTCCCG
GGACAGGCCCCGCTGCCTTCCCTAGAGCAACACTCGACTCAGAGGGGTGCCAACACCCTCCCTCTGGATAACATCCAGGGCGACATCTT
GGTTGGAATGAAGAAACAGAAGGAACGCTTC
GTCTTTTTCCACGTCAATGACGCGACCTCGTTCAAGACGGCGTTGAAGACATACGTGCCTGACCACATCACGTCGGCCCAGACCTTGATTTCAGATCCCTCTGAGCAGCCGCTGGCCTTC
GTCAACCTTGCGTTCTCGAACACAGGGCTTCAGGCGCTCGGAGTCACTGACAGTCTGGGCGACGCGCAATTCCCCAACGGCCAGTTCGCCGACGCGTCAAACCTCGGAGACGACCTTAGC
CAATGGGTGGCGCCTTTCACTGGCACCACTATCCATGGTGTTTTCTTGATTGGTAGTGATCAG
GATTCCTTCCTGGATCAGTTTGAGAACGATATCTCCACCGCTTTCGGTGCCTCGATC
ACCGAAGTACAGGCGCTGAGCGGGTCTGCTCGTCCAGGAAACCTGGCGGGCCATGAAC
ACTTCGGTTTCCTCGACGGCATCTCGCAGCCCGCAGTCACGGGTTGGGAGACGACTGTCAGG
CCAGGCCAGGCAGTTGTCCCACCAGGCATCATCCTCACCGGACGTGACGGCGACCCAACCACTCGTCCTTCATGGGCTCTCGACGGCAGTTTCATGGCGTTCCGCCACTTCCAGCAGAAG
GTCCCTGAGTTCAACGCCTACACGCTGGCCAATGCTATCCCGGCCAATAGTGCAGGAAACCTCACCCAGCAGGAGGGTGCCGAGTTCCTCGGTGCACGTATGTTTGGTCGCTGGAAGAGC
GGCGCGCCCATCGACCTCGCGCCCACTGCGGACGATCCCGCGCTCGGTGCTGACCCTCAAAGGAACAACAACTTCGATTTCTCGGATACCCTAACGGACGAGACGAAGTGCCCCTTCGCT
GCGCACATCAGGAAGACAAACCCCCGTCAGGACTTGGGTGGCCCAGTAAACACCTTCCATGCTATCCGCTCCAGTATTCCCTACGGCCCGGAGACGTCTGACGCTGAGCTTGCTTCAGGC
GTGACTTCGCAAGATCGTGGTCTTCTCTTCG
TCGAGTACCAATCCGTCATCGGCAACGGCTTCAGGTTCCAACAGATCAACTGGGTTAACAATGCAGGGTTCCCATTCTCCAAGCCAATC
GCGCCCGGTATTGACCCCATCATCGGTCAGTCGCCTACACGCTCGACGGGTGGCCTCGACCCTCTCGACCAGACGAAGACGTTCAGTGTCCCGCTGTTCGTGATCCCGAAGGGTGGAGAG
TACTTCTTCATGCCCTCCATCTCTGCGCTCACCTCCACTATCGCGGCTTGA

Retrieve as FASTA