Entry information : EcamAPx10 (EcC001124.20)
Entry ID 10234
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2012-02-02 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-02-11 (Qiang Li)
Peroxidase information: EcamAPx10 (EcC001124.20)
Name (synonym) EcamAPx10 (EcC001124.20)
Class Ascorbate peroxidase    [Orthogroup: APx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamAPx10
start..stop
S start..stop
EglAPx10 508 0 1..248 1..248
EgrAPx10 507 0 1..248 1..248
EguAPx10 504 0 1..248 1..248
EgrAPx03 455 7e-165 1..248 1..247
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..119 119 N° 2 242..416 175 N° 3 588..653 66 N° 4 1451..1499 49
N° 5 1598..1683 86 N° 6 1897..1976 80 N° 7 2071..2173 103 N° 8 2249..2359 111
join(1..119,242..416,588..653,1451..1499,1598..1683,1897..1976,2071..2173,2249.. 2359)


exon

Literature and cross-references EcamAPx10 (EcC001124.20)
Literature Naksiri,C., Nakasathien,S., Yingjajaval,S. and Udomprasert,N. Cloning and Expression of Cu/Zn SOD, APX genes in Eucalyptus camaldulensis under NaCl Stress Condition. Submitted (09-JUL-2006) Center for Agricultural Biotechnology,Kasetsart University, Malaiman Road, Kamphaeng Saen, Naknorn Pathom 73140, Thailand.

mRNA ref. GenBank:   DQ839645.1 [Fragment]
Protein sequence: EcamAPx10 (EcC001124.20)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   262
PWM (Da):   %s   28671.6  
PI (pH):   %s   6.6
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGKSYPTVSEEYKKAVEKCKKKLRGLIAEKSCAPLMLRIAWHSAGTFDVKTKTGGPFGTMKHAAELSHGANSGLDVAVRLLQPIKDQFPIITYADFYLAGVVAVEVTGGPEVAFHPGREDKPQPPPEGRLPDATKGCDHLRQVFGVQMGLSDKDIVALSGGHTGRCHKERSGFEGTWTANPLIFDNSYFKELLSGEKKELLQLPSDKALLADPVFRPLVEKYADEDAFFEDYAEAHLKLSELGYSLNFDGHSTLTVYFS*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from kazusa.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGAAGTCCTACCCGACCGTGAGCGAGGAGTACAAGAAGGCTGTCGAGAAATGCAAGAAGAAGCTGAGGGGCCTCATCGCTGAGAAGAGCTGCGCTCCGCTCATGCTCCGTATCGCG
TACGATCTCTCTCTCTCTCTCTCTTTCTCTCTTTGACCGGCGATCTCATGGTGCGAGGATTTGTGTGACGTTGGGTGTTTATGTGGGTGTGTGTGTGTGTGTGTGTGTGTGCGTCGTGCA
GGTGGCACTCCGCCGGTACCTTCGATGTGAAGACGAAGACCGGAGGCCCGTTCGGGACCATGAAGCACGCCGCGGAGCTCAGCCACGGGGCCAACAGCGGGCTCGACGTTGCCGTCAGGC
TCTTGCAGCCGATCAAGGATCAGTTCCCCATCATCACTTATGCTGATTTCTACCAG
GTCTGTTTCTTTGTTCTGTTTTTAACTATGCGGACATAGGGAAGAGCGGGCCTTGCGATCGGGT
TGTTTTGATGGCTTTAAAGCATTCATATGCAGCGGTCGACGGCCATTTCGTTCCGAATAATATGCATTTATGACCTTGTCTTGATGATGTTGTCCAATGTGATACAGCTGGCTGGCGTCG
TTGCTGTGGAAGTTACTGGTGGACCTGAAGTTGCTTTTCACCCCGGAAGAGAG
GTCGGTGATCTTGTTTGCTTTCTTTTTATCGTAGCAGGATCTATGTTTTCCTATATGATCTATATAC
ACACAGATGTGATATGATTTATGTTCCAAGAGTTGCAATGTCGATGTGTCTAGAAGCAGAAAAGGGTTGATGAAGATCAGTGCAATTCTACTATTATCAAGCAGAAAATAGTTATTATAT
TAACCAAAACACGTTTGGTCGTTACATGGTATCTGGTTTGATGCCTTCTCTCATTAGGCATGTTAAAATTATTTACAACTGTTGTTCTTTTGCCCCTTTAACCTGATCACTTGGATCTTA
CGTTTCTTTCATGGAATTGTGGGTGATATATTGACGTTCTGATGGTGAAGTAAAACCATTCACTTGTTTTTAGGTTCTTTCTTTCAGGAAACTTCACTATATATATGTATGTATGTATTT
TTCAGCTCACTTTAAAGCTACACTGTTGTGTGTTTTGGTTAGCTGAACTTGGTAGTGCAAGCCTGGGCACTTGTGCTCCCTCTTCATCATAGCATATAAGTGCTGTAATGATTTCTGAAA
ATTTCCAAAAGATCTACTGATATGCTTTGAGATATGTAAGCCACGTGACGCCTCTCCTTATGGATTTCTGATCAGATGCTGTACTGTGATTTGTGCTCTGTCAATGGCCCAGAAGCTTTT
GCTTTCTCTCAATTCACATCTTTTTTTATACTTTCTTCGCAATTTGCCATAATTTCTGTTAGCTTTAATTGTGATGCTTGCTACTTTGTTATTTATCTGGCATATTTTCACATTTTTCCA
CCAAATCCAGGACAAACCACAACCACCTCCCGAGGGCCGTCTTCCTGATGCTACCAAGGGTTAGTTTTATGTCTAGCATTTCCAGTATTTTGTCTTCGTGCTTTTAGATTCTTGATTGAA
TGTTAATCTATCGTCGTGTCTTCGACATTTCTTGCAGGCTGTGACCACTTGAGACAAGTGTTTGGTGTTCAGATGGGCCTTTCTGACAAGGATATTGTGGCCCTCTCTGGTGGCCATACC
CTG
GTTTGTGCTCAAACCTTAGATCCTCTCTTGAATTCTGATTTGTTAAGTAGGATACTATTTGTAGCAAGTTGCAGTCATATGTCATCCTATTTGCCTACAAATTATTTTGGTTTTATT
CTCCTTCGTGGTGATATGCTCTGTAAGTTCTGATGTAATTATTCAATTATTGCATTGAGTTCATTCCTTTGCTCTTTTGGTGGCACTCAATAACAGGGAAGGTGCCACAAGGAGAGGTCT
GGATTTGAAGGAACCTGGACCGCAAATCCCCTCATATTCGACAACTCGTACTTCAA
GTGAGGCTTCTAATCTTCCCGTTTTTAATCCATTGTCGGATAAAGTAATTGCCGACTTCATGCT
CATGCGGTGACTGTTTGAATCTTCGACTAGGGAATTGTTGAGCGGAGAGAAGAAAGAACTTCTTCAGCTGCCAAGTGATAAGGCTCTTCTTGCTGACCCTGTTTTCCGCCCTCTTGTTGA
GAAATATGCTGCG
GTGTGTGTTTTTCTCTTGTCGAGAATTGCTGTGCTGTTGTATGCTGGAGCTCATTGAACTTTCCTTTTGATTTAGGATGAAGATGCCTTCTTTGAAGACTATGCTGA
AGCCCATCTGAAGCTCTCTGAGCTAGGGTACTCTTTGAATTTTGATGGTCATTCTACACTTACTGTATACTTTAGTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGGAAGTCCTACCCGACCGTGAGCGAGGAGTACAAGAAGGCTGTCGAGAAATGCAAGAAGAAGCTGAGGGGCCTCATCGCTGAGAAGAGCTGCGCTCCGCTCATGCTCCGTATCGCG
TGGCACTCCGCCGGTACCTTCGATGTGAAGACGAAGACCGGAGGCCCGTTCGGGACCATGAAGCACGCCGCGGAGCTCAGCCACGGGGCCAACAGCGGGCTCGACGTTGCCGTCAGGCTC
TTGCAGCCGATCAAGGATCAGTTCCCCATCATCACTTATGCTGATTTCTACCAG
CTGGCTGGCGTCGTTGCTGTGGAAGTTACTGGTGGACCTGAAGTTGCTTTTCACCCCGGAAGAGAG
GACAAACCACAACCACCTCCCGAGGGCCGTCTTCCTGATGCTACCAAGGGCTGTGACCACTTGAGACAAGTGTTTGGTGTTCAGATGGGCCTTTCTGACAAGGATATTGTGGCCCTCTCT
GGTGGCCATACCCTG
GGAAGGTGCCACAAGGAGAGGTCTGGATTTGAAGGAACCTGGACCGCAAATCCCCTCATATTCGACAACTCGTACTTCAAGGAATTGTTGAGCGGAGAGAAGAAA
GAACTTCTTCAGCTGCCAAGTGATAAGGCTCTTCTTGCTGACCCTGTTTTCCGCCCTCTTGTTGAGAAATATGCTGCG
GATGAAGATGCCTTCTTTGAAGACTATGCTGAAGCCCATCTG
AAGCTCTCTGAGCTAGGGTACTCTTTGAATTTTGATGGTCATTCTACACTTACTGTATACTTTAGTTGA

Retrieve as FASTA