Entry information : OsPrx14
Entry ID 1024
Creation 2005-07-19 (Filippo Passardi)
Last sequence changes 2005-07-19 (Filippo Passardi)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-29 (Qiang Li)
Peroxidase information: OsPrx14
Name OsPrx14
Class Class III peroxidase    [Orthogroup: Prx099]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type Callus
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx14
start..stop
S start..stop
BdiPrx63 562 0 19..356 18..351
SiPrx01 549 0 19..326 28..339
SofPrx06 547 0 19..356 28..372
ZmPrx101 545 0 19..356 28..368
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 12534273..12534494 222 N° 2 12538930..12539355 426 N° 3 12539470..12539892 423  
join(12534273..12534494,12538930..12539355,12539470..12539892)


exon

Literature and cross-references OsPrx14
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q5U1S9
DNA ref. GenBank:   NC_008394.1 (12534273..12539889)
Protein sequence: OsPrx14
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   356 (329)
PWM (Da):   %s   37087.46 (34485.0) Transmb domain:   %s   i7-24o
PI (pH):   %s   6.11 (5.30) Peptide Signal:   %s   cut: 28 range:28-356
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAGQRVVAAVAVALGVCLLQLPAASRGQLQVGFYNTSCPNAETLVRQAVTNAFANDSGIAAGLIRLHFHDCFVRGCDASVLLTSPNNTAERDAAPNNPSLRGFQVIDAAKAAVEQSCARTVSCADIVAFAARDSVNLTGGVSYQVPSGRRDGNVSVAQDAIDNLPQPTFTAAQLVASFANKSLTAEEMVVLSGAHTVGRSFCSSFLARIWNNTTPIVDTGLSPGYAALLRALCPSNASATATTAIDVSTPATLDNNYYKLLPLNLGLFFSDNQLRVNATLGASVSSFAANETLWKEKFVAAMVKMGSIEVLTGSQGEVRLNCSVVNNRSSSSAAGMETSYHYYSGSTMSVDEVASS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, introns 1 and 3') and 2 ESTs. Containing IntR (3').
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGGTCAGCGTGTGGTGGCCGCGGTGGCCGTCGCTCTGGGCGTGTGCCTGCTGCAGCTGCCGGCGGCGAGCCGCGGCCAGCTGCAGGTGGGGTTCTACAACACCAGCTGCCCCAAT
GCCGAGACGCTGGTCCGGCAGGCCGTCACCAACGCCTTCGCCAACGACTCCGGCATCGCCGCCGGCCTCATCCGCCTCCATTTCCACGACTGCTTCGTCAGA
GTATGTTTCCTCTTCTTT
CTCTTTTCCTTTCCAAGTTTAGTTTTAGTTTTTATTCAAATTAACTAGATCGTCAGAGAAAGCGGAAGAAGAATTCCGTGGTGCTATATATTTTCATCTCTAATTTAGAGATTTTTTAAA
TGCAGTCTACTGTAAATTATAGCTAGGGAAAAACTCTACAGGTGCAATAATGCAACTAAGGTTTTTTTTGCTGTCAAACATGATAGCGAAATCTTGAAAAGTCATAATCCGTCATCAGCT
AGTGAACCCCAGCATACACAAGAGAGGCGTAAAGTCCTCTCGAATAGCAGAAAAGATCAAAGTAAAAAAAGTGAAAGCTAGCTAGCTCTCATCAAGAGTCGAGTCAAAGAAAGCGTCCAG
ATAAACAGGATAGCTAGAAATGACATTAGATGTCGACACAGCCAACACACATTTGTTCCGTTATTCTTCTACCTGCTCGCCCACCCCAATATTCTCCACTGCATTTTTCTCCTTCGACTT
TTCCTGTCCTTCACACGCAGATCTCGATGGCACGGAAACAACCCTTAATATTTTTAATCCTTTATTCAAACACAACACTCAAACTGTTATAAAACAATTTAACAACATTTATATATTACT
CCACAAAATCGTACATCTAAACTACACATACATCGAAGAAAAAAAAAAGACAAATCCAATGTATTGATAATACCTAGCACTATTCACGCCTGAATTTATCTTGTTTTTATCCCGATGTGT
AAATTAATATTAGAGTTATTTTTAGCGGATTGATAAATGTCACTACTTTACATTCTCATTTTTTTTCTAAAATTTTTCACAATCATTCATATTGAATTCGATTTAAAAAGGTATGCCCGC
AGGACCTTCGAGGGATTAGAATCAATTGTTGACAATGGCATCTCACGCATGTTCTGTCTGGTCGATTTCACTGTGCAAATGGTCCAGCTAGCTAGGATAGTTAACTGAACTGTATAGTAC
TCAGACTGTCCAAAGAATAATCTAATTCTAGTTATGAATCTGGATATGCAATCAGGATTTGTCTTTCTTTTAGATGGGGATCGATGTACATCGTAGGTAGGGAACAGGTTATTCATAGTT
GAATCTGTTCAGATAGTGGATCCATGCATGGCAACCTGAAATTAATATGGTTGCTTGTACTCATGTCCATGCTCAATTGTCGGCATCTCGTCTAGATTCTACTACTAGACAGATTTCTGG
GAGAAATCATTATATGGAGGAGATCGATGCCAGTTAGAGATAGTGACTGGCCAACTAATTCGCTGGACTTTTCTTAGAAAAAAAACTAACTCATCGTCGTCAGACATAAACGTGTTCAAC
TTGAACCTTTAATTAAGCCAGCAAGTCGGAAACCGCTGGATAAACTACGGGATACGGCTAGTTTTTGTGAGCAAAACAGATTACCCACTTCGTAGAATTGCACTATGTTTTTTTGGTTTT
GCTAATTCACTTGTTAGAGTGCGCAATCTGATCCACCAACCGTGGGCCACCCAGGTCACATTGGGTCTGCTCCATCACAGACCCAACCGGAACCACAACTTTAAATCCTGAGCCTACACA
ACCAAAAAGACTAGTCTGATGGGTGAGAACTGTCCATACCTTTTAAGTCATGCTCCCCCATCATCAATTACCTATGTGGGACTAAACCTAACAATATGATAGATTTTTGAGTTTCTATCT
TTCACTTTTTCATCCACATGATATTGCATCAATATTCGTGTTCTTCAAATTACACTCAGTTACATAGCACTTACACTCAGTTATATATACAACACTTACACACTTAATTATGTAGCACTT
GCACTAAGGCACAATGCACCAAAATTAGATTTTACAACATTTTTCCCTCTAGATTTACGATTTTTGATATGCTTATGTCTTTTTTGGGGTTATTTCAAATAAAACGGGCTATATCATTAG
TTAAAAATTATATAAGATTTAGAGCCATAAATTTGCAAGATTAATAGGTATTGCCTTTTTTTAAAACAAAAGTTCCAATATGTTTAGAGCATGGCCAGCATATATCCAAAACTGAGACTC
CTAAATCTCTTTTTAGTAACCTCTAAAATTTAAGACATGAAAACACCTTTTCTCCAAAGAAATAGCGTACCAACATGTTAGTGATATGCCCTAGAGGCAATTATAGAGATGATTGTATCA
CACACTATGTTTACATATTTATCCGACTTTGTTCCTTAAAATAGATAAACTCATTATTGGTTAATGAATATGTGATTCTTTCATGAGACTCTTTATGTTGTGTGTTGTTATTTCTAAAGG
ATCCCTGATCAAATATCATATGTGGAACAAATATGTTTAGATAATCAGCACATGTATTAATTGATGATCATGTCTCATGGATCATGGTATAGAGATACCAAATTAATAATATAGACACAT
GTTGGTGAAAATGTTGTTGGATAGACCCAACATGAGACACTGCAAGAGCCATATGTGTTGTATCATCAGTGATCTCATTTAGTATTGGTGTTGAATTCTTAGACCTAAGATTATCATGGT
TCCTAACATGTGTAGTAGCTTACTTAGGGACTGCTAAACGCTACTCCGTAATTGGGTAGTTATAAAAGTAGTTTTCGGGTATGCTATGAAATATGTAGTGGGATATGAATAATCAAGATG
GGATTTGCCCCTCCTATGGAGAGATATCTCTGGGCCCCTCAATGTTGTAGATTATGGAAGTGCATGGCCATGCCAAAGGTGATTGAGGAGTCAATCACAAGTTATATAATCTATCGACAG
GTTCGAGTGAATGATTGAGCTATTAGAGGATGGCACATATCTAGCCTTGAGCTTAATCGATATTGTGAGGCAAAGGGGTTCATACAAGTATACACTAGAGGTTCAGCCGATATGATTTTT
ATATATGCCCGGTGGGTCAATACGTTCTGCTAGGGGCCGTTGTTGACGCGTGGACCGAAAAGGAGTTTTCGGGTTACAACCGAGTTTATATGTACCTACAGGGTCGCACGTTTAATGGGC
CGGAATAAGGGGATTGGATAGAGATCCAATATGAGCTTAATTTCGGATAGGGATCCAAATAGGAGTCCTACGGGCCTTGGAGACCCGAGTGATGGATCATATATATTCGTGAGGGGTGTG
ACCGGCGGAGGCATTGCATCACGTGAGAAACCCTAGCCATCACTTCCCTCCCCGAGCAAAACCCTAGCCGCGCGCGGGTGCTAGCACATCTGCGCATGGCGTTCCGTCCCTGTACGTGTG
GATACCGGTAGAGGCACCGCTGGTTTGCGGTGCTGATCGGCGTGGGAGTACGGCGAGGAGAACGCACGAGGAGGAGAAGGTCGAGCCGGTGCGATCGACTACTTCCTCTACATCGACGCG
CGCTACTTCGCGAGAGTTCCTTCGACTTCTCAGCGTCTTCTTCTGCTGCGCAGCACGTCGAGTGGTAACGATCTATGATCTAATACTTGCATGGTTCCTGATTTACGCGATAGAAAATTT
TAATTTATGCTATCATAGTCTACGCGTATCCCAACACAACATAATCATTCTCTCCTCCGCTGACCACTCCTACCGGGTGTTTCCGTCTACTCTTGGGCAGTGCACGTACGACACGATCTC
CTCTTGACGCCGCGCGCGAGTCCTCCTCGCGCACAGATCGGGAGCAAATGATCTCTCTCCTAGATGTGGGGAACAAGAAAACCGGGGTTAGAAATTTGAATTATTGAGCGCATAAGGAAC
AATTGTTTGAATTTAATTTCTCGATAAAAATATCTAAATTTCAGGAATGCGATTTATTTTGAGATTTTGTTGGTGATTCGCTTTTAGCGATCTGCTTGTTGGCTTATCACTCCTAACTAA
AGTTTAAATTTTAAAATTGATTTTGGGTTTTATTTTTCTTCCTAGTCTATTTTGCAGCCTACTAGGTATTTAAATTGCAAATAAAATAGATATAAAAATTTTTCTATTTTTTTATTCCTT
CATACTTTTACAACTTAGGACATGCGCAATGAATATTACCCAACTAGTTAGTAAGGTGGGTCCTATGATCTAGAGGTAGTAAGCGGTAACAATTCTCACATGCTTATATGAGTACAGTGA
TAAATAAAGTGGGTCCACCTAAAAAATATCCATCCCAACCCTTTTTTATCTAGATCCTGTAAAAATATTTATATTTTATTTGGTTGTTGTCGGCAATAGCACAAATACCGGGTAGTAACT
ACTATCTCTTTCCACGATGTTTACTAGGTAGTAAGCTTGCATTAAATGTTTGTTACCTGGTTTTTTTTTGTCACATTATGATTGCTCTTATGAACCGCGCGTATCTCAACCGATTCGATT
ATATTCTTACCAAGGTAAACGAAGTCTCATATCTCACCATTTTACAGTAATCAACAGTATTTTTTATTTACTTTCTTGCCGGTTTTGTGGGTGTCAGGGTTGCGACGCGTCGGTGCTGCT
GACGTCGCCCAACAACACGGCGGAGCGCGACGCGGCGCCGAACAACCCCAGCCTCCGTGGCTTCCAGGTGATCGACGCCGCCAAGGCCGCCGTCGAGCAGAGCTGCGCGCGCACGGTGTC
CTGCGCCGACATCGTCGCGTTCGCCGCCCGCGACAGCGTCAACCTCACCGGCGGCGTCTCCTACCAGGTCCCCTCCGGCCGCCGCGACGGCAACGTCTCCGTCGCCCAGGACGCCATCGA
CAACCTCCCCCAGCCCACCTTCACCGCCGCCCAGCTCGTCGCCAGCTTCGCCAACAAGTCGCTCACCGCCGAGGAGATGGTCGTCCTCTCCGGCGCCCACACCGTCGGCCGCTCCTTCTG
CTCCTCCTTCCTCGCCCGCATCTGGAACAACACCACCCCCATC
GTACGTACATAGATCGATCGCCGGCGACGGCGACGGCGACCTCGCGGCCATTGACCATTTCGCCATTGACGTACGGC
TCACATGGCGGCGGCCGGTGTGTTCGATCGTGTGCAGGTGGACACGGGGCTGAGCCCGGGGTACGCGGCGCTGCTGAGGGCGCTGTGCCCGTCGAACGCGTCGGCGACGGCGACGACGGC
GATCGACGTGAGCACGCCGGCGACGCTGGACAACAACTACTACAAGCTGCTGCCGCTCAACCTGGGGCTCTTCTTCTCCGACAACCAGCTGCGGGTGAACGCGACGCTGGGCGCGTCGGT
GAGCAGCTTCGCGGCGAACGAGACGCTGTGGAAGGAGAAGTTCGTCGCCGCCATGGTCAAGATGGGGAGCATCGAGGTGCTCACCGGCAGCCAGGGCGAGGTCAGGCTCAACTGCAGCGT
CGTCAACAACCGGTCATCCTCCTCCGCCGCCGGGATGGAGACGTCGTACCACTACTACTCCGGATCCACCATGTCCGTCGACGAGGTCGCGTCGAGCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGGTCAGCGTGTGGTGGCCGCGGTGGCCGTCGCTCTGGGCGTGTGCCTGCTGCAGCTGCCGGCGGCGAGCCGCGGCCAGCTGCAGGTGGGGTTCTACAACACCAGCTGCCCCAAT
GCCGAGACGCTGGTCCGGCAGGCCGTCACCAACGCCTTCGCCAACGACTCCGGCATCGCCGCCGGCCTCATCCGCCTCCATTTCCACGACTGCTTCGTCAGA
GGTTGCGACGCGTCGGTG
CTGCTGACGTCGCCCAACAACACGGCGGAGCGCGACGCGGCGCCGAACAACCCCAGCCTCCGTGGCTTCCAGGTGATCGACGCCGCCAAGGCCGCCGTCGAGCAGAGCTGCGCGCGCACG
GTGTCCTGCGCCGACATCGTCGCGTTCGCCGCCCGCGACAGCGTCAACCTCACCGGCGGCGTCTCCTACCAGGTCCCCTCCGGCCGCCGCGACGGCAACGTCTCCGTCGCCCAGGACGCC
ATCGACAACCTCCCCCAGCCCACCTTCACCGCCGCCCAGCTCGTCGCCAGCTTCGCCAACAAGTCGCTCACCGCCGAGGAGATGGTCGTCCTCTCCGGCGCCCACACCGTCGGCCGCTCC
TTCTGCTCCTCCTTCCTCGCCCGCATCTGGAACAACACCACCCCCATC
GTGGACACGGGGCTGAGCCCGGGGTACGCGGCGCTGCTGAGGGCGCTGTGCCCGTCGAACGCGTCGGCGACG
GCGACGACGGCGATCGACGTGAGCACGCCGGCGACGCTGGACAACAACTACTACAAGCTGCTGCCGCTCAACCTGGGGCTCTTCTTCTCCGACAACCAGCTGCGGGTGAACGCGACGCTG
GGCGCGTCGGTGAGCAGCTTCGCGGCGAACGAGACGCTGTGGAAGGAGAAGTTCGTCGCCGCCATGGTCAAGATGGGGAGCATCGAGGTGCTCACCGGCAGCCAGGGCGAGGTCAGGCTC
AACTGCAGCGTCGTCAACAACCGGTCATCCTCCTCCGCCGCCGGGATGGAGACGTCGTACCACTACTACTCCGGATCCACCATGTCCGTCGACGAGGTCGCGTCGAGCTGA

Retrieve as FASTA