Entry information : EcamPrx93 (EcC001311.10)
Entry ID 10248
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2012-02-02 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EcamPrx93 (EcC001311.10)
Name (synonym) EcamPrx93 (EcC001311.10)
Class Class III peroxidase    [Orthogroup: Prx022]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx93
start..stop
S start..stop
EglPrx93 818 0 1..399 1..399
EgrPrx93 813 0 1..399 1..399
EguPrx93 749 0 1..399 1..399
VvPrx95 462 9e-164 4..399 10..368
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..366 366 N° 2 784..972 189 N° 3 1093..1258 166 N° 4 1410..1885 476
join(1..366,784..972,1093..1258,1410..1885)


exon

Literature and cross-references EcamPrx93 (EcC001311.10)
Protein sequence: EcamPrx93 (EcC001311.10)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   399 (378)
PWM (Da):   %s   43958.73 (41541.3)  
PI (pH):   %s   5.12 (4.99) Peptide Signal:   %s   cut: 22 range:22-399
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDWIKKLSLLTVLLCIYVALTNPNADTMRKNSPSVLWFPPPSRFTRNLSSRLMSWPQPYDGYLNGVDSATRDSAESLEYDYYRESCPQAEKIIRETVRQIYGVHSGVAPALLRLVFHDCFIKGCDASVLLDSTEVMNAEKDTPPNETLKGFDVIDVIKAEIEEVCPSVVSCADILVLAAREGLLMAGGPFYPLSTGRRDSTHSYADLATYQLPSPYGDLSDTIASFGSRGFDEREIVNLLGAHSIGVIHCKSFQSRLYNFSKTNEPDPSLDVGFLDLMRSKCSKSVSAYPSLSPAPSSSQSSFDFSNLTSEEPGVVMNYEGPSSGFGTLYYHRLLQGKGVLYADQQLMVGEETGSWVRAYASDVSLFRRDFAETMMKLSNLQVLTAPNGQVRHSCSKV

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from kazusa.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACTGGATCAAGAAACTGAGCCTCCTCACGGTCTTGCTCTGCATCTACGTTGCCCTCACCAACCCGAATGCCGATACCATGAGGAAGAACTCACCCTCGGTTCTCTGGTTCCCGCCT
CCCTCGCGCTTCACTAGGAATCTCTCGTCTCGGTTGATGTCATGGCCTCAACCGTACGACGGCTACCTCAATGGAGTTGACTCGGCGACGCGTGACTCAGCTGAGTCGCTCGAGTACGAT
TACTATCGCGAGTCGTGCCCACAAGCCGAAAAGATCATCCGAGAGACAGTCCGGCAAATTTACGGTGTTCATTCGGGTGTCGCTCCCGCTCTGTTGCGGCTTGTCTTTCACGACTGCTTT
ATCAAG
GTGATTGCCATTCTGATATGTCATTGTCTGCCGAAAGGGGTTAGGGCTTCTAATTTCTTTGTTAATTTGATTGTAGTATCTTTGTATGTTCCTGGTCGCGAGTTCTAATTACTG
CGTTTCGAAGAATTCTTTCGTAATGCTATTGTCTATCTTTATGTTGTTGCCCGTATTTGGTGTTTTTGATACTGACTGTGAAGTCAATAGTGGGGTTTTGCTCCATGTTTATATCGCTGT
GTTTCCTTAGTGATTCGGGTATAGTTGCAGCCATTGGAAATTCCACTCCTGTTGGGTGTGTTTTTCATGAATCTTCGTATTGTTTTCCTGTTGATTTTTGGGTCTTTTTCAATTCATTCC
TTTGATCGTAGACGTGACCATCTGACATTTGTAATATCTCCTGCCGAGACGAAACTGACGCAGGGATGCGATGCTTCTGTTTTGTTGGACTCGACCGAAGTGATGAACGCAGAGAAAGAT
ACGCCTCCAAATGAGACACTGAAGGGTTTTGACGTCATCGACGTCATCAAGGCCGAGATCGAAGAGGTCTGCCCCAGTGTCGTATCGTGCGCGGACATTCTTGTTTTGGCGGCCAGAGAA
GGCCTTCTCATG
GTAATTCTCTCCACCAGGATACTGCAACGTGCACATCTCCACAAATGTGATAAAAGGTCCTTCAATTTTCTGACCGAATACAAATTTGAGATTTTTGCGTACTGAGTT
GTGGAATTTCAGGCTGGAGGTCCATTCTATCCCCTGAGCACTGGCAGAAGAGACAGCACGCATTCATACGCAGATCTAGCGACTTATCAGCTTCCTTCACCATATGGAGATCTCTCCGAC
ACAATCGCATCTTTTGGATCAAGAGGATTCGATGAAAGAGAGATTGTCAATCTGCTCG
GTATCTTGCTTATCTTGATTTTTTTGCTCGCGTAATAAATGTTTCCAAGCTTAGTAACTCCT
TATTATGAAGTGGCCAATTTCTGAAACTAGCATTTATGTGGATGCAATCAATGGTTGCACTAGATTAACGCAAATCTGATATGTTTCAGGAGCTCACAGCATCGGAGTTATTCACTGCAA
ATCGTTCCAGAGTCGTCTCTACAATTTTTCCAAGACTAACGAACCTGACCCATCTCTAGATGTTGGATTCCTCGACCTAATGAGATCCAAATGCAGCAAGAGTGTCTCAGCGTATCCATC
GCTGTCTCCGGCTCCATCATCATCCCAAAGCTCGTTTGACTTCTCGAATTTGACATCTGAAGAGCCCGGTGTAGTGATGAACTATGAGGGGCCGAGTTCTGGCTTCGGGACTCTGTACTA
CCATAGGCTGCTGCAAGGTAAAGGGGTTCTCTATGCGGATCAACAGCTCATGGTGGGAGAAGAAACGGGGAGTTGGGTCAGAGCATACGCCTCAGATGTCTCTTTATTTCGCAGAGATTT
TGCTGAGACCATGATGAAGCTGTCGAACCTCCAAGTCCTAACTGCTCCTAATGGTCAGGTTCGACACAGTTGTTCAAAGGTTGCT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACTGGATCAAGAAACTGAGCCTCCTCACGGTCTTGCTCTGCATCTACGTTGCCCTCACCAACCCGAATGCCGATACCATGAGGAAGAACTCACCCTCGGTTCTCTGGTTCCCGCCT
CCCTCGCGCTTCACTAGGAATCTCTCGTCTCGGTTGATGTCATGGCCTCAACCGTACGACGGCTACCTCAATGGAGTTGACTCGGCGACGCGTGACTCAGCTGAGTCGCTCGAGTACGAT
TACTATCGCGAGTCGTGCCCACAAGCCGAAAAGATCATCCGAGAGACAGTCCGGCAAATTTACGGTGTTCATTCGGGTGTCGCTCCCGCTCTGTTGCGGCTTGTCTTTCACGACTGCTTT
ATCAAG
GGATGCGATGCTTCTGTTTTGTTGGACTCGACCGAAGTGATGAACGCAGAGAAAGATACGCCTCCAAATGAGACACTGAAGGGTTTTGACGTCATCGACGTCATCAAGGCCGAG
ATCGAAGAGGTCTGCCCCAGTGTCGTATCGTGCGCGGACATTCTTGTTTTGGCGGCCAGAGAAGGCCTTCTCATG
GCTGGAGGTCCATTCTATCCCCTGAGCACTGGCAGAAGAGACAGC
ACGCATTCATACGCAGATCTAGCGACTTATCAGCTTCCTTCACCATATGGAGATCTCTCCGACACAATCGCATCTTTTGGATCAAGAGGATTCGATGAAAGAGAGATTGTCAATCTGCTC
G
GAGCTCACAGCATCGGAGTTATTCACTGCAAATCGTTCCAGAGTCGTCTCTACAATTTTTCCAAGACTAACGAACCTGACCCATCTCTAGATGTTGGATTCCTCGACCTAATGAGATCC
AAATGCAGCAAGAGTGTCTCAGCGTATCCATCGCTGTCTCCGGCTCCATCATCATCCCAAAGCTCGTTTGACTTCTCGAATTTGACATCTGAAGAGCCCGGTGTAGTGATGAACTATGAG
GGGCCGAGTTCTGGCTTCGGGACTCTGTACTACCATAGGCTGCTGCAAGGTAAAGGGGTTCTCTATGCGGATCAACAGCTCATGGTGGGAGAAGAAACGGGGAGTTGGGTCAGAGCATAC
GCCTCAGATGTCTCTTTATTTCGCAGAGATTTTGCTGAGACCATGATGAAGCTGTCGAACCTCCAAGTCCTAACTGCTCCTAATGGTCAGGTTCGACACAGTTGTTCAAAGGTTGCT

Retrieve as FASTA