Entry information : EcamPrx04 (EcC002566.20)
Entry ID 10251
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2013-02-06 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2014-03-26 (Christophe Dunand)
Peroxidase information: EcamPrx04 (EcC002566.20)
Name (synonym) EcamPrx04 (EcC002566.20)
Class Class III peroxidase    [Orthogroup: Prx056]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx04
start..stop
S start..stop
EgrPrx04 689 0 1..330 5..334
EgrPrx13 676 0 1..330 5..334
EguPrx04 660 0 1..330 5..334
EcamPrx15 603 0 1..330 5..334
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..234 234 N° 2 434..619 186 N° 3 756..915 160 N° 4 1210..1619 410
join(1..234,434..619,756..915,1210..1619)


exon

Literature and cross-references EcamPrx04 (EcC002566.20)
Protein sequence: EcamPrx04 (EcC002566.20)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (312)
PWM (Da):   %s   37036.64 (35092.6)  
PI (pH):   %s   5.68 (5.68) Peptide Signal:   %s   cut: 19 range:19-330
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MWWQLLLSALALVSSCAAWRFEAEATIELPPPLQWHFYQNSCPDVERYVRDQVEFYWKQDSTLAVKLIQLLYTDCFIKGCDGSILLDGPDTEKTAPQNAPILGFPLEVIDKIKEVLEQHCPGVVSCADIINLAARDAVVLAGGVSYPVPTGRRDGNSSSAKLVDIAVHATPWEKVIHYFEVRGMNVFDVTTLLGGHTLGRTRCKFIAERLYDFNNTGKPDQSMDPSFLAELRVQCPPNSTNSVYLNPDSGSSNRFGKTFYSRVLNHRAVLSIDQQIADREESLQIARRYDANFEDFLKMFGYAMTKLGNTWLLPGDQGEIRKNCRVVNR

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). containing motif YTDC instead of FHDC.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTGGTGGCAGCTGTTGCTATCGGCGCTCGCGTTGGTGAGCTCGTGTGCGGCGTGGCGCTTTGAGGCCGAGGCGACGATCGAGCTGCCGCCGCCGCTGCAGTGGCATTTCTACCAGAAC
TCGTGCCCCGACGTCGAGAGGTATGTGAGGGACCAGGTCGAGTTCTACTGGAAGCAGGACAGCACCCTCGCGGTCAAGCTCATCCAACTTCTCTACACTGACTGCTTCATCAAG
GTACGT
ACCGTCTGCTCATTTCCCTCTCTCTCTCTCTCTCTCAAACGATCTCAAAGTCAGCATCGCTTCGATCATCGAGTTTCTGTCGCCCCTTCTGAGCATGCCATATACTTTCACCCAATGGTT
TAACCTCTCGGACTCGTCTTTCTAGCATACCAATCTTTTCTGAACATATGTATGGTTTATGTGGATAAAAAAGGGATGCGATGGGTCGATTCTCTTGGACGGGCCAGACACAGAGAAAAC
AGCACCACAAAATGCACCGATCCTAGGTTTTCCTCTTGAGGTGATTGACAAGATCAAGGAAGTTCTGGAACAGCACTGTCCCGGGGTCGTCTCTTGCGCCGACATTATCAACCTTGCTGC
TAGAGATGCTGTCGTCTTG
GTATGCAACATGGTTCTCAGTTTTTCCTTTTTGAGCTGGAAAAGAGATATGCTGTTAGCTTGAGTTTTGGAGCGTTCGATATGGACAGAAAAAAAAAAAAA
TCAGAATTACTGATGTGATAATGATGTTGTAATAGGCGGGAGGAGTGTCGTACCCCGTTCCGACGGGGAGGAGGGACGGAAATTCGTCCAGTGCGAAGTTGGTGGACATCGCAGTGCACG
CCACCCCGTGGGAAAAGGTGATCCATTACTTCGAAGTAAGGGGCATGAATGTGTTCGACGTCACTACTCTACTTG
GTACGGTCTAACTCTCGAATGAAAAGTGTTTATTTGACTCCGACC
TCATTACATTACCTTAAGATCTTAACCAATTCAGGCAACTCATTTAATTCAGTGAATCAAGCTGTCCATTTAGCTTTCGCTAAGTCGTAGAATTTTATCAGATATAGAATCGTCGAGGAT
GTAATCCGAAGCAATCCTCATAATGATCTCCTCCAAGTGCACAAAAATGGCATGCTCACGTAATATATCAATCTCTCAATCATAACCAATTCCTCCTTACTTTGCCAAAAACAATTTAAA
TTTTGCCAGGGGGCCATACACTGGGCAGGACCAGATGCAAGTTCATCGCAGAAAGACTGTATGATTTCAACAACACTGGCAAGCCAGACCAAAGCATGGACCCATCCTTCTTGGCCGAAT
TGAGGGTGCAATGCCCGCCCAACTCAACGAATTCAGTGTACCTTAACCCTGACTCAGGCTCGAGTAACAGGTTCGGCAAAACCTTCTACTCCAGGGTCCTGAACCACCGGGCCGTCCTCA
GCATCGACCAGCAGATCGCCGACCGTGAGGAGAGCCTCCAGATTGCCCGGCGGTACGATGCCAATTTTGAGGACTTCCTGAAGATGTTCGGCTATGCTATGACCAAGCTGGGGAACACCT
GGCTCCTGCCAGGGGATCAGGGTGAGATTCGCAAGAATTGCCGAGTCGTGAACAGGAAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTGGTGGCAGCTGTTGCTATCGGCGCTCGCGTTGGTGAGCTCGTGTGCGGCGTGGCGCTTTGAGGCCGAGGCGACGATCGAGCTGCCGCCGCCGCTGCAGTGGCATTTCTACCAGAAC
TCGTGCCCCGACGTCGAGAGGTATGTGAGGGACCAGGTCGAGTTCTACTGGAAGCAGGACAGCACCCTCGCGGTCAAGCTCATCCAACTTCTCTACACTGACTGCTTCATCAAG
GGATGC
GATGGGTCGATTCTCTTGGACGGGCCAGACACAGAGAAAACAGCACCACAAAATGCACCGATCCTAGGTTTTCCTCTTGAGGTGATTGACAAGATCAAGGAAGTTCTGGAACAGCACTGT
CCCGGGGTCGTCTCTTGCGCCGACATTATCAACCTTGCTGCTAGAGATGCTGTCGTCTTG
GCGGGAGGAGTGTCGTACCCCGTTCCGACGGGGAGGAGGGACGGAAATTCGTCCAGTGCG
AAGTTGGTGGACATCGCAGTGCACGCCACCCCGTGGGAAAAGGTGATCCATTACTTCGAAGTAAGGGGCATGAATGTGTTCGACGTCACTACTCTACTTG
GGGGCCATACACTGGGCAGG
ACCAGATGCAAGTTCATCGCAGAAAGACTGTATGATTTCAACAACACTGGCAAGCCAGACCAAAGCATGGACCCATCCTTCTTGGCCGAATTGAGGGTGCAATGCCCGCCCAACTCAACG
AATTCAGTGTACCTTAACCCTGACTCAGGCTCGAGTAACAGGTTCGGCAAAACCTTCTACTCCAGGGTCCTGAACCACCGGGCCGTCCTCAGCATCGACCAGCAGATCGCCGACCGTGAG
GAGAGCCTCCAGATTGCCCGGCGGTACGATGCCAATTTTGAGGACTTCCTGAAGATGTTCGGCTATGCTATGACCAAGCTGGGGAACACCTGGCTCCTGCCAGGGGATCAGGGTGAGATT
CGCAAGAATTGCCGAGTCGTGAACAGGAAA

Retrieve as FASTA