Entry information : EcamPrx63 (EcC033771.130)
Entry ID 10255
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2012-02-02 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-02-06 (Qiang Li)
Peroxidase information: EcamPrx63 (EcC033771.130)
Name (synonym) EcamPrx63 (EcC033771.130)
Class Class III peroxidase    [Orthogroup: Prx033]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx63
start..stop
S start..stop
EguPrx63 673 0 17..357 18..358
EgrPrx63 666 0 22..357 23..358
EguPrx62 628 0 2..356 3..360
EgrPrx62 623 0 2..356 3..360
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..228 228 N° 2 437..616 180 N° 3 773..932 160 N° 4 1042..1544 503
join(1..228,437..616,773..932,1042..1544)


exon

Literature and cross-references EcamPrx63 (EcC033771.130)
Protein sequence: EcamPrx63 (EcC033771.130)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   357 (330)
PWM (Da):   %s   37375.25 (34834.9) Transmb domain:   %s   i7-29o
PI (pH):   %s   8.32 (8.20) Peptide Signal:   %s   cut: 28 range:28-357
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTTRAGAALGLALIGLLLASLSGTCQGALQVGFYNGKCGFSDVEAIVARVVAAQFGKDPTIAPALLRMQFHDCFVTGCDASILLDGKSSEKTAPPNLSVRGYDVIDAVKAAVEAVCPGVVSCADIIVMATRDAVSLSGGGRYKVETGRKDGLVSLASNVNLPPPSISVDNSIAAFAQKGLNVSDMVLLLGGHTIGVAHCSLFQDRLYNFQSTGKPDPTMDPSLASALRSTCPNPQTNVDNIVNLDQNRLSASIVDNSFYKQILAHRGILQIDQEIALDGQTKDIVGAIAGGLDFSARFGQAMVKLGALQNGSPGEIRQSCRAINTARKLPTSKDEQRTGKRQQRDDLRAGSIPKRG

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from kazusa.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGACGCGAGCAGGTGCTGCTTTGGGACTGGCCCTGATCGGCCTCCTGTTGGCGAGCCTGAGCGGGACTTGCCAAGGCGCGCTTCAGGTTGGGTTCTACAATGGCAAATGTGGGTTC
TCGGATGTCGAGGCCATCGTGGCTCGCGTCGTGGCGGCCCAGTTCGGGAAAGACCCTACCATCGCCCCCGCTCTCCTCCGCATGCAGTTTCATGATTGCTTCGTCACT
GTAAGCTAATTA
GCCTAAATTATTTCATAATAAGCTACTTAAATATTTAATTCGGTTCCCACGCAGGTGCTTTAGAACTAGTCAATTGACTAAAAAAGAAATTATTTAGATGGACAGGATTGTTTAATACCA
GCACGTTTTGTATGTTAAAATGTTATGATGACTAGATAAATATCATCGGATTTCATTTTGATACGATGAAAATTAGGGTTGCGACGCTTCCATTCTTCTGGATGGAAAGTCGAGCGAGAA
GACGGCACCACCGAATTTGAGCGTCAGAGGCTACGATGTCATTGACGCAGTGAAGGCCGCCGTGGAGGCCGTATGCCCCGGAGTCGTTTCCTGTGCCGATATCATTGTAATGGCCACAAG
GGACGCCGTCTCCTTG
GTAATTAAATCGTATTTTTTGCATAATGCATGATAAGATGTATACACCAAGTGTCTCGATCCGGTTTCATTTTGCTCCTCATATGCTATACTTATATACGCATT
AGCTTAGTAAATTTCGTGACGTACAAGTGAGACACATGCTCAAATATTGCAGAGCGGAGGAGGTCGGTACAAGGTAGAAACGGGACGAAAAGACGGGCTCGTATCACTCGCGTCCAACGT
CAATCTGCCCCCTCCCTCCATCTCCGTCGACAACTCCATCGCGGCGTTCGCTCAAAAGGGACTCAACGTTTCCGACATGGTCCTTCTTCTAG
GTACATATATGCGGCAGTTGAAAAGCCT
AGATCCATGTAAATAAGTATAAAAGTTGTAGCGTGGTATTAGTGTTTGTTCCTGAAAAAACTGCTATCGGTGGTGTCCTAGGTGGCCACACGATCGGCGTTGCTCACTGCTCGCTCTTCC
AAGACCGCCTGTACAATTTCCAGAGTACCGGGAAACCCGACCCAACCATGGACCCTTCATTGGCTTCCGCCCTAAGGTCGACGTGCCCTAACCCTCAGACTAATGTCGACAACATTGTCA
ATCTCGACCAGAACCGTTTGAGTGCTTCGATCGTCGACAACTCCTTCTACAAGCAGATACTCGCCCATAGAGGGATACTGCAGATCGATCAGGAGATCGCACTGGACGGGCAGACCAAAG
ACATTGTGGGAGCGATCGCGGGTGGGCTCGACTTCTCGGCTAGGTTCGGCCAAGCCATGGTCAAGTTGGGCGCACTCCAGAATGGCTCCCCGGGGGAGATAAGGCAATCCTGCAGAGCTA
TCAACACGGCTCGTAAGCTGCCTACTTCCAAAGATGAGCAGAGGACAGGCAAGAGGCAGCAGAGAGACGACCTGAGAGCCGGTTCAATTCCAAAGCGTGGATTT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGACGCGAGCAGGTGCTGCTTTGGGACTGGCCCTGATCGGCCTCCTGTTGGCGAGCCTGAGCGGGACTTGCCAAGGCGCGCTTCAGGTTGGGTTCTACAATGGCAAATGTGGGTTC
TCGGATGTCGAGGCCATCGTGGCTCGCGTCGTGGCGGCCCAGTTCGGGAAAGACCCTACCATCGCCCCCGCTCTCCTCCGCATGCAGTTTCATGATTGCTTCGTCACT
GGTTGCGACGCT
TCCATTCTTCTGGATGGAAAGTCGAGCGAGAAGACGGCACCACCGAATTTGAGCGTCAGAGGCTACGATGTCATTGACGCAGTGAAGGCCGCCGTGGAGGCCGTATGCCCCGGAGTCGTT
TCCTGTGCCGATATCATTGTAATGGCCACAAGGGACGCCGTCTCCTTG
AGCGGAGGAGGTCGGTACAAGGTAGAAACGGGACGAAAAGACGGGCTCGTATCACTCGCGTCCAACGTCAAT
CTGCCCCCTCCCTCCATCTCCGTCGACAACTCCATCGCGGCGTTCGCTCAAAAGGGACTCAACGTTTCCGACATGGTCCTTCTTCTAG
GTGGCCACACGATCGGCGTTGCTCACTGCTCG
CTCTTCCAAGACCGCCTGTACAATTTCCAGAGTACCGGGAAACCCGACCCAACCATGGACCCTTCATTGGCTTCCGCCCTAAGGTCGACGTGCCCTAACCCTCAGACTAATGTCGACAAC
ATTGTCAATCTCGACCAGAACCGTTTGAGTGCTTCGATCGTCGACAACTCCTTCTACAAGCAGATACTCGCCCATAGAGGGATACTGCAGATCGATCAGGAGATCGCACTGGACGGGCAG
ACCAAAGACATTGTGGGAGCGATCGCGGGTGGGCTCGACTTCTCGGCTAGGTTCGGCCAAGCCATGGTCAAGTTGGGCGCACTCCAGAATGGCTCCCCGGGGGAGATAAGGCAATCCTGC
AGAGCTATCAACACGGCTCGTAAGCTGCCTACTTCCAAAGATGAGCAGAGGACAGGCAAGAGGCAGCAGAGAGACGACCTGAGAGCCGGTTCAATTCCAAAGCGTGGATTT

Retrieve as FASTA