Entry information : EcamPrx62 (EcC033771.140)
Entry ID 10256
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2012-02-02 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-02-06 (Qiang Li)
Peroxidase information: EcamPrx62 (EcC033771.140)
Name (synonym) EcamPrx62 (EcC033771.140)
Class Class III peroxidase    [Orthogroup: Prx031]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx62
start..stop
S start..stop
EguPrx62 658 0 1..331 1..331
EgrPrx62 658 0 1..331 1..331
EglPrx62 656 0 1..331 1..331
EguPrx63 583 0 1..331 1..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..231 231 N° 2 407..586 180 N° 3 745..904 160 N° 4 1031..1464 434
join(1..231,407..586,745..904,1031..1464)


exon

Literature and cross-references EcamPrx62 (EcC033771.140)
Protein sequence: EcamPrx62 (EcC033771.140)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   335 (315)
PWM (Da):   %s   35277.16 (33328.0)  
PI (pH):   %s   7.93 (7.66) Peptide Signal:   %s   cut: 29 range:21-335
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATLRAGAALGLAWIGLVLASLSGSCHGALQVGFYNGKCRVSDVEAIVAGVVAARFSKDPTIAPALLRMQFHDCFVTGCDASILLDGKSSEKTAPPNLSVKGYDVIDSAKAAVEAICPGVVSCADIIVMATRDAVSLSGGGRYRVETGRKDGLVSLASNVDLPPPSISVNDSIAAFAQKGLTVSDMVLLLGGHTIGIAHCSLFQDRLYNYQNTGKPDPTMDPSLASALRSTCPNKQTNVDNIVNLDQDPLSSSIVDNSFYKQILARRGILQIDQEIALDRQTKDIVGAIAGRLDFSTRFGQAMVKLGTLQNGAPGEIRQSCRAINTARKLPFFQ

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from kazusa.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGACGCTGCGAGCAGGTGCTGCTTTGGGACTGGCCTGGATCGGCCTCGTGTTGGCGAGCCTGAGCGGGTCTTGCCACGGTGCTCTTCAGGTCGGGTTCTACAATGGCAAATGTAGG
GTCTCCGATGTCGAGGCCATCGTGGCCGGCGTCGTGGCGGCCCGGTTCAGCAAGGACCCCACCATCGCCCCCGCTCTCCTCCGCATGCAGTTTCATGATTGCTTCGTCACT
GTAAGCTAA
TTAGCCTAAATTACTTCATGAAAAGCTACTTAAATGTTCAATTTGGTTCCCCCGCACGTGCTTTAGAACTAGTCTATTGACTAATAAAGAAATTATGTAGATGGATGGGATTGTGTAAGA
CCGGCTCGTTTTGTATGTTAAAATGTTACAATGACTAAATAATTAGGGCTGCGACGCCTCCATTCTTCTGGACGGAAAATCGAGCGAGAAGACTGCGCCGCCAAATTTGAGTGTCAAGGG
CTACGATGTCATTGACTCCGCAAAGGCTGCCGTGGAGGCCATATGCCCCGGGGTTGTTTCCTGCGCCGATATCATTGTCATGGCAACTAGAGATGCCGTGTCCCTG
GTAATTAAATCGTA
TTTTCCGCATAACTCATGATAAGATGCATGCGCTAAGCGTCTCGATCCAGTGACATTCTGTTCTTCTCATATGCTATACTTATATACACATTGGCTTAGTAAATTTCATGACGTACGCGT
GAGACACATGCTCAAATATTGCAGAGCGGAGGAGGTCGGTACAGGGTAGAAACGGGACGGAAAGACGGGCTCGTATCGCTCGCGTCCAACGTCGATCTCCCCCCTCCCTCCATCTCCGTC
AATGACTCCATCGCGGCATTCGCTCAAAAAGGACTCACCGTTTCCGACATGGTCCTTCTTCTAG
GTACGTATATGCAGCATCGTCTTCCCCATCAATTGAAAACCCCAGATCCATGCAAA
TAAGTTCGAAAGTTGTAGTCTGGTATGGTGTTTTTGTTCTTATAAAAAACTGCTACTGGTCGTGTCCTAGGTGGCCACACGATCGGCATTGCTCACTGCTCGCTCTTCCAAGACCGGCTT
TACAATTACCAGAATACCGGGAAACCTGACCCGACCATGGACCCTTCCTTGGCTTCCGCCCTAAGGTCGACGTGCCCTAACAAGCAGACTAACGTCGACAACATTGTCAATCTCGACCAG
GATCCTCTGAGCTCATCGATCGTCGACAACTCCTTCTACAAGCAGATACTCGCCCGTAGAGGGATTCTGCAGATCGATCAGGAGATCGCGCTGGACAGGCAGACCAAGGACATTGTGGGA
GCGATCGCCGGCAGACTTGACTTCTCGACTAGGTTTGGCCAAGCCATGGTTAAGTTGGGCACACTCCAGAATGGCGCTCCTGGGGAGATAAGGCAATCCTGCAGAGCTATCAATACGGCT
CGTAAGCTGCCCTTCTTCCAAAGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGACGCTGCGAGCAGGTGCTGCTTTGGGACTGGCCTGGATCGGCCTCGTGTTGGCGAGCCTGAGCGGGTCTTGCCACGGTGCTCTTCAGGTCGGGTTCTACAATGGCAAATGTAGG
GTCTCCGATGTCGAGGCCATCGTGGCCGGCGTCGTGGCGGCCCGGTTCAGCAAGGACCCCACCATCGCCCCCGCTCTCCTCCGCATGCAGTTTCATGATTGCTTCGTCACT
GGCTGCGAC
GCCTCCATTCTTCTGGACGGAAAATCGAGCGAGAAGACTGCGCCGCCAAATTTGAGTGTCAAGGGCTACGATGTCATTGACTCCGCAAAGGCTGCCGTGGAGGCCATATGCCCCGGGGTT
GTTTCCTGCGCCGATATCATTGTCATGGCAACTAGAGATGCCGTGTCCCTG
AGCGGAGGAGGTCGGTACAGGGTAGAAACGGGACGGAAAGACGGGCTCGTATCGCTCGCGTCCAACGTC
GATCTCCCCCCTCCCTCCATCTCCGTCAATGACTCCATCGCGGCATTCGCTCAAAAAGGACTCACCGTTTCCGACATGGTCCTTCTTCTAG
GTGGCCACACGATCGGCATTGCTCACTGC
TCGCTCTTCCAAGACCGGCTTTACAATTACCAGAATACCGGGAAACCTGACCCGACCATGGACCCTTCCTTGGCTTCCGCCCTAAGGTCGACGTGCCCTAACAAGCAGACTAACGTCGAC
AACATTGTCAATCTCGACCAGGATCCTCTGAGCTCATCGATCGTCGACAACTCCTTCTACAAGCAGATACTCGCCCGTAGAGGGATTCTGCAGATCGATCAGGAGATCGCGCTGGACAGG
CAGACCAAGGACATTGTGGGAGCGATCGCCGGCAGACTTGACTTCTCGACTAGGTTTGGCCAAGCCATGGTTAAGTTGGGCACACTCCAGAATGGCGCTCCTGGGGAGATAAGGCAATCC
TGCAGAGCTATCAATACGGCTCGTAAGCTGCCCTTCTTCCAAAGA

Retrieve as FASTA