Entry information : EcamPrx67 ( EcC035941.10)
Entry ID 10260
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2012-02-06 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-25 (Christophe Dunand)
Peroxidase information: EcamPrx67 ( EcC035941.10)
Name (synonym) EcamPrx67 ( EcC035941.10)
Class Class III peroxidase    [Orthogroup: Prx019]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx67
start..stop
S start..stop
EgrPrx67 657 0 1..325 1..325
EguPrx68 650 0 1..325 1..325
EglPrx67 649 0 1..325 1..325
EgrPrx68 647 0 1..325 1..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..207 207 N° 2 310..507 198 N° 3 1081..1246 166 N° 4 1890..2293 404
join(1..207,310..507,1081..1246,1890..2293)


exon

Literature and cross-references EcamPrx67 ( EcC035941.10)
Protein sequence: EcamPrx67 ( EcC035941.10)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (303)
PWM (Da):   %s   35436.14 (33070.9)  
PI (pH):   %s   9.78 (9.77) Peptide Signal:   %s   cut: 23 range:23-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEARRFLVSCLSFALLLSAVSAQLRTDFYKNTCPNVESLVRSAVTKKFQQTFVTAPATLRLLFHDCFVRGCDGSVLIASPTNNAEKDHPDDLSLAGDGFDTVIKAKAAVDSVPQCKNKVSCADILTLAARDVVSLAGGPFYSVELGRRDGRISTKLSVQHNLPQPGSKLDQLNSMFSSRGLSQTDMIALSGAHTIGFSHCGKFSKRIYNFSPRSPIDPTLNFGYALQLRQMCPIKVDPRIAINMDPTTPQTFDNAYYKNLQQGKGLFVSDQTLFSDPRSRATVNLFASKNAAFRQAFVTAITKMGRIGVKTGNQGEIRIDCTRP

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGCTCGTAGGTTTCTCGTGTCGTGCCTGAGCTTTGCCCTTCTGTTAAGTGCAGTCTCGGCTCAGCTCAGGACGGATTTCTACAAGAACACGTGCCCGAACGTCGAGTCCCTCGTC
CGGTCGGCCGTGACCAAGAAGTTCCAGCAGACCTTCGTCACCGCCCCTGCAACTCTCCGCCTCTTGTTCCACGATTGCTTCGTCAGG
GTTGGTTTTGAAACAAAGTATTCTATACATAAT
AATGTTGGCTTGATTGTTAATTGTTTGCTTCTTCTTCTTCTTTTTCGTTCGTTTTGGGGATTTGATTAGGGATGCGATGGTTCGGTGCTCATAGCGTCGCCCACCAACAACGCCGAGAAA
GACCATCCCGATGACCTGTCGCTCGCTGGCGACGGGTTCGACACTGTGATCAAAGCTAAGGCAGCGGTGGATAGTGTTCCTCAGTGCAAAAACAAAGTCTCTTGTGCCGATATCTTGACT
CTTGCCGCTAGAGATGTCGTTTCGTTG
GTACGATAAGGGCCCCCCACTGAACTCCTTTCCCAATTTTTTCATTTCACGAAATCGAGCATCCATCTAACTTTTTCAGTCCGGTGAAAAGCA
AACCATTCAAATTGAGCTCGAAAATTTATGAAAAATTACTTTAGAGGCACGTAGTTTTCGAACCCTTATAGAGTGCTCGACTACTTTCTTAGAATATGCCAATATGCTTTTCGTTTCCAC
GACATGACGAAATTATAATATGCTTTTGTTTTGTACCAAAGAAAAATAATAGTCTATTCATATAAACTTTTTAGTACAAATTTCTTTTCTTGTTACACTGAAAAACCATTGGGTCCCTTT
CATAATGCCTGTCCTTTTCTCCCTCCTCCACATCAATAGCATGTACGGAAGTTTGATGCAACGGGTTAACAAGAAAGTCGACAACAAGCACCACCCAACGCTACTTTTTCCTGTCAAACC
ACTCAAAATTGCGATTAATTTTCGTCCATTTTATTCTTTTCATTTTAGCAAATTGATAATGTCACACGGTCATTTCATAATCACTTGCTATTCTTTGCAAAATTTGGAAATTTTGTGTAG

GCAGGGGGGCCGTTCTATAGTGTTGAATTGGGGAGACGCGATGGAAGAATATCAACTAAACTTAGTGTCCAACACAATCTTCCTCAGCCTGGTTCCAAATTGGACCAGCTCAATTCTATG
TTCTCTTCTCGTGGTCTCTCCCAAACTGACATGATCGCCTTATCAG
GTAATTAATTACATCTTATTATGAGATTTGGTGGATTACTAAGCAAATAGATCAAGAGACCACATAATTACATG
TTAATCTCATATATATATATATATATATATATATATATATTACTTAAGCATTTTGAACCCACAAAGCCATTCTTTCGAAGAATTGTTTCTAAGCGTGACACAGAATTCTAAATTACAAAA
TTAATGCAGCATAAGCTCTAAAAAAAAAAATTGTAATGTAATTTGCAAAATATACATGAAAGAGTAATTGGGTAAGACGTCAAGTTAAGGTGCATGACAACTTTCACTTTATGCAACACA
TCCTTGTCTATCATCTAATTATAATAATAGGAAGCGGAAGAAAAGTGTTCATAGGTACCCAATGGCTTCTTATTGGAGCAATGTGCTAGACAACTAGGCAAGCATTGTAGTCCACTTGAT
TACCTCTAGATTCATTTATATAGCATATCATAGCTCAGACGTTTGTAGTCTAATGTTTATCATAGTCCAATCATACTCTCTTTCAGGATAGAATAGCATATGTAACTATTAAGCCGGTAG
TCATTGACAAGTTCACAAAATTATTCAATTTCAAACGCTAAAGTTTGATTTTTCCCGGGTAACTCACATCGTAACCACTGCGTTTGTAGGCGCGCACACGATTGGATTCTCTCACTGCGG
CAAATTCTCCAAGCGGATCTACAACTTCAGCCCGAGAAGCCCGATCGATCCGACCCTGAACTTCGGCTACGCCTTGCAGCTGAGGCAGATGTGCCCGATCAAGGTGGACCCCCGGATCGC
CATCAACATGGACCCCACAACGCCTCAGACGTTCGACAACGCCTACTACAAGAACCTCCAACAAGGAAAGGGCCTCTTCGTCTCCGACCAGACATTGTTCTCCGACCCGAGATCGAGGGC
CACGGTCAACCTGTTCGCATCAAAAAACGCGGCGTTCCGACAGGCCTTCGTCACTGCGATCACAAAGATGGGTCGGATCGGGGTCAAGACCGGGAACCAGGGTGAGATTAGGATTGATTG
CACTCGCCCCAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGGCTCGTAGGTTTCTCGTGTCGTGCCTGAGCTTTGCCCTTCTGTTAAGTGCAGTCTCGGCTCAGCTCAGGACGGATTTCTACAAGAACACGTGCCCGAACGTCGAGTCCCTCGTC
CGGTCGGCCGTGACCAAGAAGTTCCAGCAGACCTTCGTCACCGCCCCTGCAACTCTCCGCCTCTTGTTCCACGATTGCTTCGTCAGG
GGATGCGATGGTTCGGTGCTCATAGCGTCGCCC
ACCAACAACGCCGAGAAAGACCATCCCGATGACCTGTCGCTCGCTGGCGACGGGTTCGACACTGTGATCAAAGCTAAGGCAGCGGTGGATAGTGTTCCTCAGTGCAAAAACAAAGTCTCT
TGTGCCGATATCTTGACTCTTGCCGCTAGAGATGTCGTTTCGTTG
GCAGGGGGGCCGTTCTATAGTGTTGAATTGGGGAGACGCGATGGAAGAATATCAACTAAACTTAGTGTCCAACAC
AATCTTCCTCAGCCTGGTTCCAAATTGGACCAGCTCAATTCTATGTTCTCTTCTCGTGGTCTCTCCCAAACTGACATGATCGCCTTATCAG
GCGCGCACACGATTGGATTCTCTCACTGC
GGCAAATTCTCCAAGCGGATCTACAACTTCAGCCCGAGAAGCCCGATCGATCCGACCCTGAACTTCGGCTACGCCTTGCAGCTGAGGCAGATGTGCCCGATCAAGGTGGACCCCCGGATC
GCCATCAACATGGACCCCACAACGCCTCAGACGTTCGACAACGCCTACTACAAGAACCTCCAACAAGGAAAGGGCCTCTTCGTCTCCGACCAGACATTGTTCTCCGACCCGAGATCGAGG
GCCACGGTCAACCTGTTCGCATCAAAAAACGCGGCGTTCCGACAGGCCTTCGTCACTGCGATCACAAAGATGGGTCGGATCGGGGTCAAGACCGGGAACCAGGGTGAGATTAGGATTGAT
TGCACTCGCCCCAAC

Retrieve as FASTA