Entry information : EcamPrx91 ( EcC037392.50)
Entry ID 10263
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2012-03-19 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-22 (Christophe Dunand)
Peroxidase information: EcamPrx91 ( EcC037392.50)
Name (synonym) EcamPrx91 ( EcC037392.50)
Class Class III peroxidase    [Orthogroup: Prx022]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx91
start..stop
S start..stop
EglPrx91 808 0 1..399 1..399
EguPrx91 806 0 1..399 1..399
EgrPrx91 800 0 1..393 1..393
PpePrx50 479 1e-170 66..395 8..344
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..342 342 N° 2 436..633 198 N° 3 979..1144 166 N° 4 1250..1740 491
join(1..342,436..633,979..1144,1250..1740)


exon

Literature and cross-references EcamPrx91 ( EcC037392.50)
Protein sequence: EcamPrx91 ( EcC037392.50)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   399 (378)
PWM (Da):   %s   43850.73 (41521.4) Transmb domain:   %s   i5-22o
PI (pH):   %s   5.25 (5.25) Peptide Signal:   %s   cut: 22 range:22-399
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPNSLNGWIVIFVLLVSFLVSFRNRKGSSADQRGRPFDPPFSLDPLSPVLLQRNDDGAAVDDEDPALGLQYDFYRNTCPAAEEIVRSSMSRIYSQHPDVAPAFLRLLFHDCFIRGCDASVLLDDSHGNRSHPIERQAIPNRTLKGFDRIDTIKQELEDHCPGVVSCADVLVLATREGILLAGGPFYPLFTGRRDSIQSYYADAMAEIPKPDDNVFRTLHLFGLRGFDERETVSLLGGHNIGKIGCEFILERLHNFLGTGQPDPTISADFLSEMRRNCGDSQTSSNSSSGSPLLMESTSLTKSDLGLTYFPQLATSISSGSSFDTHYYQSLLRGRGLLYADQQLMADERTASVVRAYASDDGSAFRLDFARAMMKMSSLGILSGSDGQIRKNCSFVANV

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCAACTCCCTGAACGGCTGGATCGTCATCTTCGTCCTCCTCGTCTCCTTCCTCGTCTCCTTCAGGAACCGCAAGGGCTCGAGCGCCGACCAGCGTGGGCGGCCCTTCGACCCTCCC
TTCTCTCTCGACCCCCTCTCGCCCGTCCTTCTCCAGCGGAACGACGACGGCGCCGCCGTCGACGATGAAGACCCCGCGCTCGGGCTCCAGTACGACTTCTACCGCAACACCTGCCCTGCT
GCGGAAGAAATCGTGAGGTCTTCCATGTCCAGGATCTACTCCCAACACCCCGACGTCGCCCCCGCGTTTCTCCGTCTCCTCTTCCACGACTGCTTCATCAGG
GTTCCTCCTCCTCCTCCT
TCTTCGTTTCTGCTTTGTGGGGTTCCTCGTTTAGGGGCTGATTGCCATTGGGTTTGGGTTATTTTCTCGAGTCAGGGTTGCGATGCTTCAGTTCTCCTGGACGATAGCCATGGAAACCGC
AGTCACCCCATCGAAAGGCAGGCCATCCCCAACCGGACCCTCAAGGGTTTCGACAGGATCGATACCATCAAGCAGGAGCTTGAAGATCATTGCCCTGGGGTTGTTTCTTGTGCCGATGTT
CTCGTGCTCGCCACCCGGGAGGGCATCCTCCTG
GTACGCTCTTCTCTCGTTCCCCTCTTCCAATTTCAAGAAACTGTCCCGTCCCCTGTCATCGCCATCCGTTCATGCGGATTTCTATGA
AATTTAGTATTCTCATATGGGCATTGCATGGCGCCCTCTGTGGAAAATTTTATTGATGATTCTCAAAGTCAGCTTGGCATTTGGGAAGATTTCATCTACTCCACGTCTAGGAACTTCTTT
CTTTCTTCTATGTTTCCAGGCTTGCAGCTGGACGACAGCTACTTGATTAGTTTGTTCGAGCTTCTTAAGAATCTCTGTTTCTGTTTCCTTTTAACTCCTTATCCTATTCACCTCGTCTTT
TGATGTTCGAGTCCACAGGCTGGTGGCCCATTCTATCCCCTTTTCACTGGCAGGAGAGACAGTATTCAGTCCTATTATGCAGATGCAATGGCTGAAATTCCTAAGCCAGACGATAATGTC
TTCCGGACGCTCCACCTGTTTGGTCTCAGAGGTTTTGACGAGAGAGAAACAGTCAGTCTCTTAG
GTATTATTACTAAAGTCCATCCTTCTATCTTACTTTGTGGTCGAGTTTGTTTGAAT
TGTGAGTGGATAACCAGGCACTGAATTGATTAATTCTGTTGATATGAAGGAGGTCACAATATCGGCAAGATTGGTTGCGAGTTCATCTTAGAACGCTTGCACAATTTCTTAGGGACAGGT
CAGCCAGACCCAACCATATCTGCAGATTTTCTTAGTGAGATGAGACGCAACTGTGGAGACAGTCAGACCAGCAGCAATAGCAGCAGTGGCTCTCCACTGCTCATGGAATCAACGAGCCTT
ACTAAGTCTGATTTGGGTTTGACATACTTCCCACAGTTAGCGACTTCAATTTCTTCCGGATCAAGCTTTGACACCCATTACTACCAGAGCTTGCTTAGAGGGAGAGGTCTTCTATATGCT
GATCAGCAGTTAATGGCTGACGAGAGAACTGCAAGTGTCGTAAGGGCTTATGCCTCAGATGACGGATCAGCCTTCAGATTGGACTTTGCTCGTGCTATGATGAAAATGTCAAGTCTTGGT
ATATTGTCTGGATCAGATGGGCAGATCCGAAAAAATTGCTCGTTTGTCGCCAACGTCAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCCAACTCCCTGAACGGCTGGATCGTCATCTTCGTCCTCCTCGTCTCCTTCCTCGTCTCCTTCAGGAACCGCAAGGGCTCGAGCGCCGACCAGCGTGGGCGGCCCTTCGACCCTCCC
TTCTCTCTCGACCCCCTCTCGCCCGTCCTTCTCCAGCGGAACGACGACGGCGCCGCCGTCGACGATGAAGACCCCGCGCTCGGGCTCCAGTACGACTTCTACCGCAACACCTGCCCTGCT
GCGGAAGAAATCGTGAGGTCTTCCATGTCCAGGATCTACTCCCAACACCCCGACGTCGCCCCCGCGTTTCTCCGTCTCCTCTTCCACGACTGCTTCATCAGG
GGTTGCGATGCTTCAGTT
CTCCTGGACGATAGCCATGGAAACCGCAGTCACCCCATCGAAAGGCAGGCCATCCCCAACCGGACCCTCAAGGGTTTCGACAGGATCGATACCATCAAGCAGGAGCTTGAAGATCATTGC
CCTGGGGTTGTTTCTTGTGCCGATGTTCTCGTGCTCGCCACCCGGGAGGGCATCCTCCTG
GCTGGTGGCCCATTCTATCCCCTTTTCACTGGCAGGAGAGACAGTATTCAGTCCTATTAT
GCAGATGCAATGGCTGAAATTCCTAAGCCAGACGATAATGTCTTCCGGACGCTCCACCTGTTTGGTCTCAGAGGTTTTGACGAGAGAGAAACAGTCAGTCTCTTAG
GAGGTCACAATATC
GGCAAGATTGGTTGCGAGTTCATCTTAGAACGCTTGCACAATTTCTTAGGGACAGGTCAGCCAGACCCAACCATATCTGCAGATTTTCTTAGTGAGATGAGACGCAACTGTGGAGACAGT
CAGACCAGCAGCAATAGCAGCAGTGGCTCTCCACTGCTCATGGAATCAACGAGCCTTACTAAGTCTGATTTGGGTTTGACATACTTCCCACAGTTAGCGACTTCAATTTCTTCCGGATCA
AGCTTTGACACCCATTACTACCAGAGCTTGCTTAGAGGGAGAGGTCTTCTATATGCTGATCAGCAGTTAATGGCTGACGAGAGAACTGCAAGTGTCGTAAGGGCTTATGCCTCAGATGAC
GGATCAGCCTTCAGATTGGACTTTGCTCGTGCTATGATGAAAATGTCAAGTCTTGGTATATTGTCTGGATCAGATGGGCAGATCCGAAAAAATTGCTCGTTTGTCGCCAACGTCAAT

Retrieve as FASTA