Entry information : ZmaPrx05 ( Zosma20g00680 [2.2])
Entry ID 10265
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2016-04-07 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-04-07 (Achraf Jemmat)
Peroxidase information: ZmaPrx05 ( Zosma20g00680 [2.2])
Name (synonym) ZmaPrx05 ( Zosma20g00680 [2.2])
Class Class III peroxidase    [Orthogroup: Prx208]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Zosteraceae Zostera
Organism Zostera marina    [TaxId: 29655 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value ZmaPrx05
start..stop
S start..stop
ZmaPrx04 594 0 1..316 1..316
ZmaPrx20 490 1e-176 1..315 1..318
ZmaPrx[P]44 432 7e-154 1..315 1..315
RcPrx27 394 6e-139 1..315 1..318
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 445879..446082 204 N° 2 446178..446369 192 N° 3 446525..447079 555  
join(445879..446082,446178..446369,446525..447079)


exon

Literature and cross-references ZmaPrx05 ( Zosma20g00680 [2.2])
DNA ref. Phytozome 12:   scaffold_20 (445879..447079)
Cluster/Prediction ref. Phytozome Gene 12:   33165803
Protein sequence: ZmaPrx05 ( Zosma20g00680 [2.2])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   316 (294)
PWM (Da):   %s   34428.75 (32227.6)  
PI (pH):   %s   8.56 (8.72) Peptide Signal:   %s   cut: 23 range:23-316
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAASSFESAILIALLLPLTTSALSSNYYSKSCPNLFKVVYPVIAKAIKQQPRNGASILRLFFHDCFVNGCDGSILLDDTPTFTGEKTAFPNLNSVRGFNVIDDVKAAVEDACPGVVSCADILAIASLDAVHILGGPWWKLKLGRLDARTASRDLANKNIPAPSLNLKGLKTAFENVGLSEKDVVVLSGGHTIGLARCVTFRNHIYNDTDIDPKFAANRQKTCPRSGGNNNLAPLDTKSGRIFDNFYYQDLVRKRGLLHSDQALFDDVATDDLVLKYSKDETEFFKDFGKSMIKMGNIKPSSGTHLEVRKNCRVVNT*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCGAGTTCGTTCGAATCAGCCATTTTGATTGCTCTTCTTCTTCCATTAACTACTTCTGCATTGTCTTCAAATTATTACTCCAAATCCTGCCCCAACCTGTTCAAAGTCGTATAT
CCGGTGATAGCTAAAGCCATAAAACAGCAGCCTCGCAATGGTGCATCCATTCTGCGTCTCTTCTTCCACGACTGCTTCGTCAAT
GTTCGTCGTCGCAGCATTATTTTTTGTAATTTGATA
AATTGATCTTCAATAATATTGTTGATTGTTATATATATATATTATGGATCGGAGTACAGGGATGCGATGGATCAATTCTCTTAGACGACACACCGACTTTCACCGGAGAGAAAACGGCAT
TTCCGAACTTAAACTCTGTCAGAGGATTTAATGTCATCGACGATGTAAAAGCCGCGGTGGAAGATGCATGTCCCGGAGTTGTCTCGTGTGCGGATATTTTGGCCATCGCCAGTCTAGATG
CTGTGCACATA
GTAAGTTTAATTATTGTCCAATTAAATAGTTAAGTTAATGATCTGTGTCGTTCATTTTTTTACTTTTAAATCTGTTTATTTTCTAACCAATAGATCAAATTTCAACGGT
GAGATAAAAGTTTCTCTAACCCTAACTCTAAAAAATACAACTGCAGTTGGGGGGTCCATGGTGGAAGTTGAAGCTCGGAAGACTAGATGCAAGAACGGCGAGTCGAGATTTGGCAAACAA
AAACATCCCCGCTCCTTCTTTGAACCTTAAAGGCCTCAAAACAGCATTTGAAAACGTGGGTCTTTCCGAAAAAGATGTAGTCGTTCTCTCCGGTGGGCACACCATAGGTCTAGCAAGATG
TGTCACATTCAGAAACCACATATACAATGACACCGACATCGACCCCAAATTCGCCGCCAACCGTCAGAAAACATGTCCAAGATCTGGTGGCAACAACAACCTTGCTCCGCTTGACACCAA
ATCGGGAAGAATCTTCGACAACTTCTACTACCAAGATCTTGTGAGGAAAAGAGGGCTTCTTCATTCGGATCAGGCTTTATTCGACGACGTAGCCACCGACGATCTCGTGTTGAAGTACAG
CAAAGATGAGACCGAGTTCTTCAAAGACTTCGGGAAATCTATGATAAAAATGGGTAACATTAAACCCAGTAGCGGGACTCATCTGGAAGTAAGAAAGAATTGTAGGGTGGTGAACACTTA
A

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCGAGTTCGTTCGAATCAGCCATTTTGATTGCTCTTCTTCTTCCATTAACTACTTCTGCATTGTCTTCAAATTATTACTCCAAATCCTGCCCCAACCTGTTCAAAGTCGTATAT
CCGGTGATAGCTAAAGCCATAAAACAGCAGCCTCGCAATGGTGCATCCATTCTGCGTCTCTTCTTCCACGACTGCTTCGTCAAT
GGATGCGATGGATCAATTCTCTTAGACGACACACCG
ACTTTCACCGGAGAGAAAACGGCATTTCCGAACTTAAACTCTGTCAGAGGATTTAATGTCATCGACGATGTAAAAGCCGCGGTGGAAGATGCATGTCCCGGAGTTGTCTCGTGTGCGGAT
ATTTTGGCCATCGCCAGTCTAGATGCTGTGCACATA
TTGGGGGGTCCATGGTGGAAGTTGAAGCTCGGAAGACTAGATGCAAGAACGGCGAGTCGAGATTTGGCAAACAAAAACATCCCC
GCTCCTTCTTTGAACCTTAAAGGCCTCAAAACAGCATTTGAAAACGTGGGTCTTTCCGAAAAAGATGTAGTCGTTCTCTCCGGTGGGCACACCATAGGTCTAGCAAGATGTGTCACATTC
AGAAACCACATATACAATGACACCGACATCGACCCCAAATTCGCCGCCAACCGTCAGAAAACATGTCCAAGATCTGGTGGCAACAACAACCTTGCTCCGCTTGACACCAAATCGGGAAGA
ATCTTCGACAACTTCTACTACCAAGATCTTGTGAGGAAAAGAGGGCTTCTTCATTCGGATCAGGCTTTATTCGACGACGTAGCCACCGACGATCTCGTGTTGAAGTACAGCAAAGATGAG
ACCGAGTTCTTCAAAGACTTCGGGAAATCTATGATAAAAATGGGTAACATTAAACCCAGTAGCGGGACTCATCTGGAAGTAAGAAAGAATTGTAGGGTGGTGAACACTTAA

Retrieve as FASTA