Entry information : OsPrx17 (LOC_Os01g36240)
Entry ID 1027
Creation 2006-07-17 (Filippo Passardi)
Last sequence changes 2006-07-17 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-09-24 (Christophe Dunand)
Peroxidase information: OsPrx17 (LOC_Os01g36240)
Name (synonym) OsPrx17 (LOC_Os01g36240)
Class Class III peroxidase    [Orthogroup: Prx001]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue types Leaves
Pannicles
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx17
start..stop
S start..stop
SiPrx16 596 0 1..335 5..337
ZmPrx61 589 0 16..334 19..335
SbPrx65 589 0 24..335 35..343
SofPrx02 584 0 24..335 32..340
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 20058150..20058380 231 N° 2 20058523..20058714 192 N° 3 20060216..20060381 166 N° 4 20061843..20062264 422
join(20058150..20058380,20058523..20058714,20060216..20060381,20061843..20062264 )


exon

Literature and cross-references OsPrx17 (LOC_Os01g36240)
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q8RYP0
DNA ref. GenBank:   NC_008394.1 (20058150..20062261)
Protein sequence: OsPrx17 (LOC_Os01g36240)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   336 (317)
PWM (Da):   %s   36365.29 (34419.2) Transmb domain:   %s   i5-27o
PI (pH):   %s   7.03 (7.03) Peptide Signal:   %s   cut: 20 range:20-336
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAFAFLLVIAIVFPLASAFPSPPVSWGQQQLDPHFYDHSCPQAQQIVASIVGKAHYQDPRMAASLLRLHFHDCFVKGCDASILLDSSATIMSEKRSNPNRDSARGFEVIDEIKAALEAACPHTVSCADILALAARDSTVMTGGPGWIVPLGRRDSRGASVQGSNNDIPAPNNTLPTIITKFKLQGLDIVDLVALLGSHTIGDSRCTSFRQRLYNQTGNGLPDFTLDASYAAALRPRCPRSGGDQNLFFLDPVTPFRFDNQYYKNLLAHRGLLSSDEVLLTGGNPATAELVELYAADQDIFFAHFARSMVKMGNISPLTGGNGEVRTNCRRVNHNY

Retrieve as FASTA  
Remarks chromosome 1. 3 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCCTTTGCCTTCCTACTAGTCATCGCCATCGTCTTCCCCCTCGCATCCGCATTCCCTTCCCCTCCTGTTTCATGGGGCCAACAGCAGCTAGACCCTCACTTCTACGACCACTCG
TGCCCACAAGCACAGCAAATCGTGGCATCTATCGTCGGGAAAGCGCATTACCAGGACCCCCGCATGGCCGCATCCCTCCTCCGTCTCCACTTCCACGACTGCTTTGTCAAG
GTACATAGT
TACATATGGGATTTTTTTTTCTCTAAAGAGCGAAAAAAAGACCTGTATCTCTTCCCATTTTATATGGAGGAGTTCATTAATTGTACAATACAATGGCTCGATGAGTGAATTACAAAAAAT
AATGCATTTGCAGGGCTGCGACGCGTCGATCCTACTAGACAGCAGTGCGACGATCATGAGCGAGAAGCGGTCGAACCCTAACCGGGACTCTGCGAGGGGGTTCGAGGTGATCGACGAAAT
CAAGGCGGCGTTGGAGGCCGCTTGCCCACACACCGTCTCTTGCGCTGACATCCTTGCCCTCGCCGCGCGTGACTCCACCGTCATG
GTATATATACATTTTCTAGACCTCCCTATTACATT
TTCTTTTCATATTCGAATAGTTAGGTTAATTGCTTTTATGAATGTAGTGCATATGTTGAGAATATATGCTTTTGCATTGTCTAAAAAGCTAGCCGCGGATTTGGATTGACTGCAACTTGT
TGTGTGTACGTATAATATGCATCATGTCGGACTTGGTCAGCCAGTAAGCTAAGCTAGGTCTGTACACGCACTGAAGGACATATTCATTCTTGTTTCCACACTTTACTTATGTACAGATTA
TGTGTAAGCTTTTCAAAAGATGGTTTATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATACCCATAATG
TTTTTCCTAACAAATCTCTATGGTTGGGAACACATGGCATAAAAGTATAGTATCTCGATCTCCTGTGTCGAGCTATTTGGATGGGCCCAGCAGTGCACTATAGCTACAACATATAGTTCC
AGACCCAGTCTAGAGCTAGCTAGGACAAAGTAGAACACATCACCATTATTCACCAAAAGCAGCTACTTAGCTATCTCCATGTGTTGTTGTGTAGAAGGAAAAGGATAAAGCTAGCAATGC
AAAGTCGACACAAAGTAGGGTCACATTGCTCGGTAAAGCATATGCAGCGCCAAAGCTATCTACAGTTCCTCTCTCCCTCACAAAACAAAACGAAAGCTATCTACAGTTACAAAATAACAA
AGCATTGGCCATTGCGCGTCATGGTTAAAGGCGTAGTAAATTAAAAGTGACAAAGTACATGTACCACCTGGGTTTTTATTTATTTTTGACTGAAACGTCGTTAGCTAAAGCTTGGGTTTA
TTTAAGAGAGTTAGTTATATTAACATGTGCATCATCAATTAATTGGTGTGTGCGTGCGTCATATTGTTGTGGACGATATAATTAACAATAATCCTCGATCAAGGTTTCCTTTCGATAAGC
TTGAGTTCATGTTAATTGTTCTTTTCTATGTGCTTAATTATGAAGAAATCTTAAAAAGGTTGATTTTGAGGACCACATAAACATATTGGAATTTTCTACCAAATCAAGCCCCTCAGTACA
AGAACTGTACTGAATGGCATTAGGCTTAAACAAGCAAATATAATATTTCTCAATCCTTTCAAGAAGAACAGTAAAACAAAATCTTAGGATTATCTTTTTGATGGAAGTATTATAAAATTC
TGGGGATGCTCATAGGATAGGATGTACGCATATGATCATAGTGGCGAGTGTGTGTATACACGCGTGTATACGAGAGCATCATCTCATTTGTTCTGCGTTTCAGAGAAAGAATTATTTTGG
GCCGGTTTAATTAATTGTCTAGGCTCATGCAGAACATTCGATCAGTAGTCAACTAGTCATTGGTTCTGGATCTACCAATCTTTTTTGTCATGACAATACCGAAATGAAAACCTTAGCTTA
ATTGCTTGCATTGCTCGTACGTGCAGACGGGAGGCCCCGGGTGGATAGTGCCGCTGGGGAGGAGGGACTCGCGTGGGGCGAGCGTGCAGGGCTCCAACAACGACATCCCGGCTCCCAACA
ACACCCTCCCCACCATCATCACCAAGTTCAAGCTCCAGGGCCTCGACATCGTCGACCTCGTCGCCCTCCTCG
GTATTTATATTATGTCGCATATGATTTATAATCTATCCTTTATATATA
TTGTTACGACTTAACCTATTTGTCAGTGACTGTTGTTATATAGCGCTAGTGACTATATAGCTTGTCGGTGACTATTTGCAGTAACTTTCACATGCTTATTTAGGTTTAGAGCACTTAACT
AGGTAGCCTCTTTTTTTTTATCTCCATCTCTCTAGCTAGGACCTACTCTGTAAAAAAAAATCAACCTAGTATTGAATGAGACATTTTCTAATATAACGAATCTGAACAAGCTTCTGTCCA
GATTCGTTATATAAGAAAAACGTCCGATCCAATCTTAGAATGGTTTGTTGTAGGATAGAGGGAGTAGGAAGGGGAAACTATTCTAATCCCTCGAGGGGATGTTCCCTCCTTTGCTCAAAA
ACCATATAAATGGTTATAAAAAATTCTGGAAAAATTTAACAATATTCATACAACACATATATACAACTTCACAAAATCTTAAGTCCAAACTCAACTCACACGTCGAGATATAAAAAAGAC
AAATTCAGCATATGAATAGTAGCGTACTGTTTATATCTAAATTTGTCTTTTTTGTTTCTCGATGTGTAGATCGAATTTGAACATGAATTTTGGTGGACTAGTAGGTATCATTATACTCTA
CATTGTCAATTTTTTTCAGATTTTTTCACAACTATTTGCATCGAATTTAGAAGAAAAAGATATACGAGGGGATATTCCCTCGAGGGATTAGAATCCACTCCCAGGAGAAAGCTAGGTAGC
TAGAGTTGGTGGCTTAGCTCGACGATGCATGGTACTTGTAGGACGCAACATGCATGGCTTCTGACGTGTCCAAGGACACCGTAGATCCATGCAACTCATTGGTACCTCTCACAACTGTAG
CTTGTGTCACATGTTGCACCCAAATACATAACCACCGTTGAAATTCTCAGGAGCTAGCTAGAGAGCAGCAGTACCTGGATCCTCAGATGTCGTATCCAGACATATCACCGACACATTTCA
AGACCTAAACACCTACTATCTGTCTAAACAGACAAAAGCGTAGGCTGGTGCCACAAATCAATCATTTCCCAACCAACATCGCGACACAAGTGCTAAAACTTTATGTATATGAAAAGAGTT
TGTTTTAGTCCAGCAAAAATTTTTTCTTTGAGGTGCCAGTATCTCACGATACCAGATTGTTGGATCCAATAATGCCCATCCTAGCTAGCTAGATCCAACAATCGAAAACAATTTGGTACC
GTGAGATATTAGTATCTCGAGATACTTTTAGCTAGACCGGAACAAATCTCATATGAAAAATATCCAAAATGATATCCATCCATCCCATTCACTGATCGACAGAATTATTCTGCACATATA
TTTCGGCTGAATTATTTACAGTAAATAACTGAATTAGACTTGATGTCGTGTGTCAAAAAAATTGTTGTAATTATCTGCATATTTGACTGACAGGTAGCCACACCATCGGCGACTCCCGGT
GCACGAGCTTCCGGCAGCGGCTGTACAACCAGACGGGGAACGGCCTGCCGGACTTCACGCTGGACGCGTCGTACGCGGCGGCGCTGCGGCCGCGGTGCCCGCGCTCCGGCGGCGACCAGA
ACCTCTTCTTCCTCGACCCCGTCACCCCCTTCAGGTTCGACAACCAGTACTACAAGAACCTGCTCGCCCACCGCGGCCTCCTCAGCTCCGACGAGGTGCTCCTCACCGGCGGCAACCCGG
CCACGGCGGAGCTCGTCGAGCTCTACGCCGCCGATCAGGACATCTTCTTCGCCCACTTCGCGCGGTCCATGGTCAAGATGGGCAACATCTCGCCGCTCACCGGCGGCAACGGCGAGGTCA
GGACCAACTGCAGGAGGGTCAACCACAACTACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCCTTTGCCTTCCTACTAGTCATCGCCATCGTCTTCCCCCTCGCATCCGCATTCCCTTCCCCTCCTGTTTCATGGGGCCAACAGCAGCTAGACCCTCACTTCTACGACCACTCG
TGCCCACAAGCACAGCAAATCGTGGCATCTATCGTCGGGAAAGCGCATTACCAGGACCCCCGCATGGCCGCATCCCTCCTCCGTCTCCACTTCCACGACTGCTTTGTCAAG
GGCTGCGAC
GCGTCGATCCTACTAGACAGCAGTGCGACGATCATGAGCGAGAAGCGGTCGAACCCTAACCGGGACTCTGCGAGGGGGTTCGAGGTGATCGACGAAATCAAGGCGGCGTTGGAGGCCGCT
TGCCCACACACCGTCTCTTGCGCTGACATCCTTGCCCTCGCCGCGCGTGACTCCACCGTCATG
ACGGGAGGCCCCGGGTGGATAGTGCCGCTGGGGAGGAGGGACTCGCGTGGGGCGAGC
GTGCAGGGCTCCAACAACGACATCCCGGCTCCCAACAACACCCTCCCCACCATCATCACCAAGTTCAAGCTCCAGGGCCTCGACATCGTCGACCTCGTCGCCCTCCTCG
GTAGCCACACC
ATCGGCGACTCCCGGTGCACGAGCTTCCGGCAGCGGCTGTACAACCAGACGGGGAACGGCCTGCCGGACTTCACGCTGGACGCGTCGTACGCGGCGGCGCTGCGGCCGCGGTGCCCGCGC
TCCGGCGGCGACCAGAACCTCTTCTTCCTCGACCCCGTCACCCCCTTCAGGTTCGACAACCAGTACTACAAGAACCTGCTCGCCCACCGCGGCCTCCTCAGCTCCGACGAGGTGCTCCTC
ACCGGCGGCAACCCGGCCACGGCGGAGCTCGTCGAGCTCTACGCCGCCGATCAGGACATCTTCTTCGCCCACTTCGCGCGGTCCATGGTCAAGATGGGCAACATCTCGCCGCTCACCGGC
GGCAACGGCGAGGTCAGGACCAACTGCAGGAGGGTCAACCACAACTACTGA

Retrieve as FASTA