Entry information : EcamPrx192 (EcC045496.50)
Entry ID 10275
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2012-02-02 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EcamPrx192 (EcC045496.50)
Name (synonym) EcamPrx192 (EcC045496.50)
Class Class III peroxidase    [Orthogroup: Prx037]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx192
start..stop
S start..stop
EgrPrx192 712 0 1..346 1..346
EglPrx192 712 0 1..346 1..346
EguPrx192 705 0 1..346 1..346
TsPrx09 535 0 2..346 1..352
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..270 270 N° 2 549..740 192 N° 3 974..1139 166 N° 4 1326..1735 410
join(1..270,549..740,974..1139,1326..1735)


exon

Literature and cross-references EcamPrx192 (EcC045496.50)
Protein sequence: EcamPrx192 (EcC045496.50)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   346 (322)
PWM (Da):   %s   36974.69 (34569.4)  
PI (pH):   %s   5.66 (5.96) Peptide Signal:   %s   cut: 25 range:25-346
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVALSEVVFALVASAFLLSTPSTAHPGLGFGWGGGSSGSGGGHGLFPEYYLYSCPQVNDIVVSVLEQAIEREPRMAASLLRLHFHDCFVQGCDASVLLDDSATIASEKRSLPNANSLRGFEVIDEIKAKLEEVCPGVVSCADIVALAARGSTVLSGGPDWELPLGRGDSRTASLTGSNNNIPPPNSTIQNLITLFQRQGLNEADLVALSGGHTIGVARCTSFKQRLYNQNGNNQPDATLERTYYQDLKTVCPQSGGDNNISPLDIASPVKFDNSYFKLILWGKGLLNSDEVLLTGKVGKTMNLVKAYAEDESLFLQQFAKSMIKMGNISPLIGFNGEVRKNCRHV

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from kazusa.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGGCTCTCTCCGAAGTAGTCTTTGCTCTTGTGGCCTCGGCTTTCCTGTTGTCCACACCTTCCACAGCTCACCCGGGCCTTGGCTTTGGTTGGGGTGGGGGCTCCAGCGGAAGTGGC
GGGGGTCATGGCCTGTTTCCCGAATACTATCTTTACTCGTGCCCTCAAGTGAACGACATTGTTGTTTCGGTGCTGGAGCAAGCCATCGAAAGGGAACCGAGGATGGCAGCTTCCTTGCTC
CGGCTTCATTTCCACGACTGCTTTGTGCAG
GTTTGATTTTCACAAGTTTGGCAACCGGTTTTATGATTGCTTCAGAACTCGCGAAAAATATATTCTCAACGGCAAGAAAGGTATCAAAGG
GGATTGATGCAAAATGACAAGAGCTAAGAAAACTAACAGTAGTCGGGTGTTTTCCCTCTCCCGATGCAAGTCAGAGAGACTAAAGCATATGCCTACGTTACCTAAAGAAATGTCGGGTTG
GATCCATTAGAGCTGCTTAGTGCCTGCAATGTAGGAGTAGCCGTTGCTTAACAAGCTATTTGTTGTAGGGATGTGATGCATCAGTTCTGCTGGACGATAGTGCGACCATAGCCAGCGAGA
AGAGGTCGCTGCCTAATGCAAACTCCCTCAGGGGGTTTGAAGTGATAGATGAAATCAAGGCCAAGTTGGAAGAAGTGTGCCCTGGTGTTGTGTCTTGTGCAGATATTGTCGCCCTTGCAG
CTCGTGGATCTACCGTTCTG
GTACGTTAGATACTCCTTTTGTATTCCTCACTCTTGAATGCTTAAATGTCAAGATCAAAACCGTGAGTCACTTCCACTTAAAATCCCCAGTTTAGACTTA
CCAAAGGTGTCCATATTCGAACATGTAAGACCGCCAAGACCATCAGAAAGTGACATTTCTTCTGTAGTTTTACTTCCTTAGATTGAACAATTTAGCTTCATTTTTTTTTTTTTTTCCGGT
TGAGATTTAACAGAGCGGTGGACCAGATTGGGAGCTTCCTCTTGGAAGGGGGGACTCTAGAACAGCAAGTCTTACGGGCTCTAATAACAATATCCCCCCTCCAAACTCCACAATCCAAAA
TCTCATCACACTCTTCCAGCGCCAAGGCCTAAATGAAGCCGATCTCGTCGCTCTCTCAG
GTACCACCCATTATTCAGCACTGAAAAATCATTAGGTGGGCTCTCTCTGTCACCGATTTTC
TAAATTAATGTTGATTACAGCAAGGCAAAAACATGAAAACTGATTTCTGTTACCGATTTCTTTCCTTTTCATAATAAGATTCTGTCAGTGTAACATATTGTGAATTTTATCGTCGGTATC
TGCAGGAGGGCACACGATTGGGGTGGCGAGGTGTACAAGCTTCAAGCAGAGGCTGTACAACCAGAATGGGAACAACCAACCCGATGCGACTCTTGAGAGGACCTACTACCAGGATCTGAA
AACAGTTTGCCCTCAGTCGGGTGGTGACAACAACATCTCTCCCCTGGACATTGCTTCCCCGGTCAAGTTTGACAACTCCTACTTCAAGCTTATATTATGGGGCAAAGGCCTTCTCAATTC
AGATGAAGTGCTCTTAACCGGAAAAGTGGGGAAGACTATGAATCTGGTCAAAGCCTATGCAGAAGACGAGAGCCTCTTCCTCCAGCAGTTTGCCAAGTCCATGATCAAGATGGGTAACAT
CAGTCCTCTCATTGGGTTTAACGGCGAAGTGAGAAAGAATTGTCGCCATGTTAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGGCTCTCTCCGAAGTAGTCTTTGCTCTTGTGGCCTCGGCTTTCCTGTTGTCCACACCTTCCACAGCTCACCCGGGCCTTGGCTTTGGTTGGGGTGGGGGCTCCAGCGGAAGTGGC
GGGGGTCATGGCCTGTTTCCCGAATACTATCTTTACTCGTGCCCTCAAGTGAACGACATTGTTGTTTCGGTGCTGGAGCAAGCCATCGAAAGGGAACCGAGGATGGCAGCTTCCTTGCTC
CGGCTTCATTTCCACGACTGCTTTGTGCAG
GGATGTGATGCATCAGTTCTGCTGGACGATAGTGCGACCATAGCCAGCGAGAAGAGGTCGCTGCCTAATGCAAACTCCCTCAGGGGGTTT
GAAGTGATAGATGAAATCAAGGCCAAGTTGGAAGAAGTGTGCCCTGGTGTTGTGTCTTGTGCAGATATTGTCGCCCTTGCAGCTCGTGGATCTACCGTTCTG
AGCGGTGGACCAGATTGG
GAGCTTCCTCTTGGAAGGGGGGACTCTAGAACAGCAAGTCTTACGGGCTCTAATAACAATATCCCCCCTCCAAACTCCACAATCCAAAATCTCATCACACTCTTCCAGCGCCAAGGCCTA
AATGAAGCCGATCTCGTCGCTCTCTCAG
GAGGGCACACGATTGGGGTGGCGAGGTGTACAAGCTTCAAGCAGAGGCTGTACAACCAGAATGGGAACAACCAACCCGATGCGACTCTTGAG
AGGACCTACTACCAGGATCTGAAAACAGTTTGCCCTCAGTCGGGTGGTGACAACAACATCTCTCCCCTGGACATTGCTTCCCCGGTCAAGTTTGACAACTCCTACTTCAAGCTTATATTA
TGGGGCAAAGGCCTTCTCAATTCAGATGAAGTGCTCTTAACCGGAAAAGTGGGGAAGACTATGAATCTGGTCAAAGCCTATGCAGAAGACGAGAGCCTCTTCCTCCAGCAGTTTGCCAAG
TCCATGATCAAGATGGGTAACATCAGTCCTCTCATTGGGTTTAACGGCGAAGTGAGAAAGAATTGTCGCCATGTTAAT

Retrieve as FASTA