Entry information : EcamPrx44 ( EcC045690.10)
Entry ID 10276
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2012-02-02 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-13 (Christophe Dunand)
Peroxidase information: EcamPrx44 ( EcC045690.10)
Name (synonym) EcamPrx44 ( EcC045690.10)
Class Class III peroxidase    [Orthogroup: Prx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx44
start..stop
S start..stop
EgrPrx44 651 0 1..329 1..333
EglPrx44 647 0 1..329 1..333
EguPrx44 622 0 25..329 3..307
PtPrx08 514 0 21..328 25..330
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..73 73 N° 2 1025..1173 149 N° 3 1334..1528 195 N° 4 1750..1915 166
N° 5 2218..2621 404  
join(1..73,1025..1173,1334..1528,1750..1915,2218..2621)


exon

Literature and cross-references EcamPrx44 ( EcC045690.10)
Protein sequence: EcamPrx44 ( EcC045690.10)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (304)
PWM (Da):   %s   36429.95 (33744.5)  
PI (pH):   %s   5.11 (4.90) Peptide Signal:   %s   cut: 26 range:26-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATGSFHHYSLGFVLLSLLLQLLSGSSELQSNYYAESCPNAEEIIKQEVAKLYDEHGNTAISWIRNLFHDCMVSCDASLLLESKLGNGIVSEQASSRSFGMRNFKYVTKIKEALEKECPATVSCADIIALSARDGTVLLGGPRIEMRSGRRDGRESHASVVEEFIPNHNDSMALVLSRFESVGIDAEGTVALLGAHSVGRVHCVNLYDRLYPTVDPTLDSDYAEYLKGRCPMPDPNPEKVRYSRNDRETPMVLDNMYYKHLLAHKGLLLVDQQLASDPTTAPFVEKMAADNGYFQDQFARAMLALSENNPLTGDEGEIRKDCRYINA

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns and extra 5'). Correct prediction from kazusa.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCACCGGAAGCTTCCATCATTACAGCTTAGGCTTTGTCCTTCTGTCATTGCTCCTCCAGCTTCTATCGGGTGAGACACACTAACCCTTTTTCCTTATTCGAGCTCGGTAGTTGGTC
TGTTCATATTTTAAATAATCGTAAGCAATAGCATCGAGCGGGTGTTTCCAAGACTCGATCCATTACCTCAAGCCGATCACATGTTGAAGTTGACTAGATGTGCTCTTAAGCATATGTTAT
CTGAATTGTTTTATTGCTCAGTTTTTTATGGAGATGTTGAATGACGTATCGTAAGTAATAATTTGGATTTTAGGAGGATGACCCCTAGAGCATCAAATGTTACCAACATTATCAAGCAAC
AGATCATCTTCTTTCATGATCCATGCATAGAAAGTAGGATAATATCTCCCTCTAACAATACTTTTAATTAGAGAATTACAAGTTATAGATATCACTCACATGCAAACTTAACTAGTTGCG
ACCTATCAATTGAAAATATGACTAAAGAAATTTTCTTGCAACTAGAAATTGGACAAAAACATGGCCCTAGAAATTTTCAAGTAATTGATGTTGCCAATTCTATTTTTATTGCCAAAAACA
CAGTATTGATTTCCTTTGAAGAAGATTTTTCTTTTCTTTTTTTTAAGAACACCAGGTGGAGCGGGCACAAGTCAACTTTAGCACATGAACATATGGGTCTCTCCAATGGGACCCATGATG
TGATTTTAGAAGCTGATCACCCGAATGTTTTCCTGTGGATAACAAACGATGATGCGATGTTACTGCTCGTTGAGTACTAATGGAGACTTGCTCATAACCTAACAAACCAGAGGAAAATAA
AATTACAATCTTATAAAAAAATTGACGATCTTAATCACAAGAAATAGTAAACATTTGTGTGTCGCACGCTTATGAAGAAAGGTCACCTGTGGATCTATTTGCCGTCCATGAAATGATGAG
CCAAATTCTTTCTACTGAAGCAAGTTCTTGCTTTTTTTCCTTGCTTCTTTAGTTACGTGCACAGGTTCCAGTGAACTTCAGTCGAATTACTATGCCGAGAGCTGTCCGAACGCAGAAGAA
ATCATCAAACAAGAAGTCGCCAAGCTCTACGATGAACATGGCAATACCGCCATCTCCTGGATTCGCAATCTCTTTCATGACTGCATGGTCCAA
GTACGTATATCTATCTATACACATGAA
CACACGCACAAACACTGCATGTATAGTCCTCAAATTAGTGTTGAAGCATGCTGAATTATCTTTCATCTTCTGGGTATCGAACGGAACTGATGTACGACTCTCTGTCGCTGACCTCTTTGT
GACGAATCGCTAGTCCTGCGATGCCTCGCTCCTGCTAGAATCAAAGCTCGGAAACGGGATCGTGTCGGAGCAGGCATCTTCGAGGAGCTTCGGGATGAGGAATTTCAAGTACGTGACGAA
GATCAAGGAGGCTCTCGAGAAGGAATGCCCCGCGACGGTCTCTTGCGCCGACATCATCGCCCTCTCCGCGAGAGATGGCACCGTTCTC
GTAAGTGTTTCGATAATTCACTTTTACGCCAT
CTTTTTTTCTGCCCGGCTTGCGTAAAACACGGAGCCTGCCAAAGGGACGGATCTTTTCGAAACTTCCACATTAAAATGATCTCGAAACCGACACAGACCAGCTTCCCAGTTCCCCGACAG
AACTCGAGAATTATCGATGTCTCTGAAAGTAGCTTGATCTCCATACTATACGTCGGTTTGTTTGTACAGTTAGGAGGACCGCGCATCGAAATGAGAAGTGGAAGGAGAGACGGCAGAGAA
AGTCACGCGAGTGTGGTGGAAGAATTCATTCCTAACCATAATGATTCGATGGCGTTGGTGCTTTCTCGTTTTGAATCTGTTGGCATCGATGCTGAAGGAACAGTCGCTCTCCTTG
GTAAG
TGTTTGATATATGTAGTTCACCAAGTTCATGCATCTTTGAACATGCCTTGTCCGTGTCTGGTTTATTTAACTGGACCCGGGTATCCCAGACGATGTTGCTGTTCCGTAATAGAAAGATCG
CTTCATGCATCATTTGATATAATCTCGTATGATGTATATCGGTTAGGGTTTATCTTGTTCATCGTTCTTAACGCATGATTTCTATCCAATATCGAAGTGGATTGTAGTAATAGAAATTCA
GACTTTCAGCGATAAAACTTTTCCCATCTCATTAATTGGCATCCATTCGCTGATCAGGAGCTCATTCGGTTGGTCGAGTTCATTGCGTCAACCTATACGACAGACTCTACCCAACCGTGG
ACCCAACCTTAGACTCGGACTACGCCGAATACCTGAAAGGCCGGTGCCCGATGCCAGACCCAAACCCGGAGAAGGTGCGGTACTCGAGGAACGACAGAGAGACTCCGATGGTGCTGGACA
ACATGTACTACAAGCACCTGTTGGCTCACAAGGGACTGTTGCTGGTAGATCAGCAGTTGGCTTCAGATCCAACAACCGCTCCCTTCGTGGAGAAGATGGCTGCCGACAACGGCTACTTCC
AGGACCAGTTCGCGAGGGCCATGCTCGCGTTGTCCGAGAACAATCCTCTCACGGGAGATGAAGGAGAAATTAGGAAGGACTGCAGATACATTAATGCAGTC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCACCGGAAGCTTCCATCATTACAGCTTAGGCTTTGTCCTTCTGTCATTGCTCCTCCAGCTTCTATCGGGTTCCAGTGAACTTCAGTCGAATTACTATGCCGAGAGCTGTCCGAAC
GCAGAAGAAATCATCAAACAAGAAGTCGCCAAGCTCTACGATGAACATGGCAATACCGCCATCTCCTGGATTCGCAATCTCTTTCATGACTGCATGGTCCAA
TCCTGCGATGCCTCGCTC
CTGCTAGAATCAAAGCTCGGAAACGGGATCGTGTCGGAGCAGGCATCTTCGAGGAGCTTCGGGATGAGGAATTTCAAGTACGTGACGAAGATCAAGGAGGCTCTCGAGAAGGAATGCCCC
GCGACGGTCTCTTGCGCCGACATCATCGCCCTCTCCGCGAGAGATGGCACCGTTCTC
TTAGGAGGACCGCGCATCGAAATGAGAAGTGGAAGGAGAGACGGCAGAGAAAGTCACGCGAGT
GTGGTGGAAGAATTCATTCCTAACCATAATGATTCGATGGCGTTGGTGCTTTCTCGTTTTGAATCTGTTGGCATCGATGCTGAAGGAACAGTCGCTCTCCTTG
GAGCTCATTCGGTTGGT
CGAGTTCATTGCGTCAACCTATACGACAGACTCTACCCAACCGTGGACCCAACCTTAGACTCGGACTACGCCGAATACCTGAAAGGCCGGTGCCCGATGCCAGACCCAAACCCGGAGAAG
GTGCGGTACTCGAGGAACGACAGAGAGACTCCGATGGTGCTGGACAACATGTACTACAAGCACCTGTTGGCTCACAAGGGACTGTTGCTGGTAGATCAGCAGTTGGCTTCAGATCCAACA
ACCGCTCCCTTCGTGGAGAAGATGGCTGCCGACAACGGCTACTTCCAGGACCAGTTCGCGAGGGCCATGCTCGCGTTGTCCGAGAACAATCCTCTCACGGGAGATGAAGGAGAAATTAGG
AAGGACTGCAGATACATTAATGCAGTC

Retrieve as FASTA