Entry information : HaPrxII03 (HanXRQChr12g0359601)
Entry ID 10278
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2016-05-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-11-23 (Catherine Mathe (Scipio))
Peroxidase information: HaPrxII03 (HanXRQChr12g0359601)
Name (synonym) HaPrxII03 (HanXRQChr12g0359601)
Class Atypical 2-Cysteine peroxiredoxin (type II)    [Orthogroup: PrxII001]
Taxonomy Eukaryota Viridiplantae Streptophyta Asteraceae Helianthus
Organism Helianthus annuus (Sunflower)    [TaxId: 4232 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HaPrxII03
start..stop
S start..stop
NtPrxII06a 321 6e-114 1..197 1..193
NtPrxII06b 320 2e-113 1..197 1..193
IbPrxII06 319 4e-113 1..197 1..193
PtPrxII06 318 8e-113 1..197 1..203
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 17271587..17271790 204 N° 2 17271455..17271484 30 N° 3 17270918..17271076 159 N° 4 17270708..17270802 95
N° 5 17270439..17270544 106  
complement(join(17270439..17270544,17270708..17270802,17270918..17271076,1727145 5..17271484,17271587..17271790))


exon

Literature and cross-references HaPrxII03 (HanXRQChr12g0359601)
DNA ref. HanXRQ genome:   HanXRQChr12 (17271790..17270439)
EST ref. GenBank:   GE515985.1
Cluster/Prediction ref. HanXRQ:   HanXRQChr12g0359601
Protein sequence: HaPrxII03 (HanXRQChr12g0359601)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   197
PWM (Da):   %s   21278.87  
PI (pH):   %s   9.07
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAYAALKRSSTMKSMATRIGQSWRQFASVSVGSDLVAAAPNVSLQKARTWDEGVSSQFSTTPLSEIFKGKKVVIFGLPGAFTGVCTSQHVPSYKKNIDKFKAKGVDSVICVSVNDPYTMNGWADKLEAKDAIEFYGDFDGKFHKSLELDLDLSAALLGHRSTRWSAFVEDGKVKVLNVENVPSDFKVSGGEVILGQI

Retrieve as FASTA  
Remarks Complete sequence from genomic and EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTACGCAGCGTTGAAACGATCGTCAACAATGAAGTCAATGGCCACCAGAATCGGTCAATCATGGCGGCAGTTTGCTTCCGTTTCAGTCGGCAGCGATCTCGTTGCAGCCGCTCCC
AATGTTTCGCTCCAGAAGGCTCGAACCTGGGACGAAGGTGTCTCGTCTCAGTTCTCCACCACTCCTCTCTCTGAAATTTTCAAG
GTCTGTTTCTTTTTTTTTTGTTGCAGTTGCTTTTGT
GGTTGTTGAATTGTTTTAGGGTTTTATCAGGTTATTGAATGTTCTGTTTTTGTATGTTTTTTTCAGGGTAAAAAGGTCGTCATATTTGGGCTTCCTGTAAGTTTGTTCTTGTATACTGTA
CCATTTGTGTTGTTTTATCATTTAGTATTGTGCTTTCATTTCATTTCTAGTTTAATTTGATAGTGTTGATAATTTTTGGGTAATTTTGATGGATGGAGACCTGAAAAACTGCTAATTATT
TGTCCTTTAAAGTTGGATGATTTCAAGCAGTGTTAGGATGATGATTGTTGTTTGTTAGTTGCAATTTGAATTCCTTTATTTTTGAATTGCTTTAGAGCAAACTTGTTATTTACTTGAATT
ATATACAAGGATTTGATGGCATAATACACAAAATAGAACAGGATTATGTGGCTACAACATTATCCATCCTCTATAACCGTCTCTCGTAAATAATCTCGGCTGTGGGAATTTTAGGGTGCA
TTCACGGGAGTTTGTACAAGTCAGCATGTTCCAAGTTACAAGAAAAACATCGACAAGTTCAAGGCTAAAGGTGTTGATTCGGTTATCTGTGTGTCGGTTAATGATCCATACACCATGAAT
GGCTGGGCTGATAAGCTTGAAGCTAAAGATGCT
GTAAGTTGCTCCTCATGCCTTTTTTTTATTCAAATGAAAATTTACATGTGATCTTCAGTCAATCTTTTCATCTAGATAGTGACATTT
AATGTTGTTTCATGTTCGTACCATGCAGATTGAATTCTACGGAGACTTTGATGGTAAATTTCACAAGAGCTTGGAGCTGGACTTAGATCTCAGTGCTGCATTGCTTGGACATCGCTCAAC
TAG
GTATCACTCTAATTTGCACGTTTCTGTATCGTAATATTTAACTTCAGAGTCATTCAACAACTAGTGAATATCTGTACTTTAAAACCTTTTGATAATGTAATAATTTATTTAATTAAT
CTTGTTATGCTCATCGGTGGATTATTCTGTGACATATTTTTCCCAGATGGTCGGCATTTGTGGAGGACGGCAAGGTTAAGGTTCTGAACGTCGAGAATGTTCCTTCTGACTTTAAGGTTT
CCGGAGGTGAGGTAATCTTGGGGCAGATATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTACGCAGCGTTGAAACGATCGTCAACAATGAAGTCAATGGCCACCAGAATCGGTCAATCATGGCGGCAGTTTGCTTCCGTTTCAGTCGGCAGCGATCTCGTTGCAGCCGCTCCC
AATGTTTCGCTCCAGAAGGCTCGAACCTGGGACGAAGGTGTCTCGTCTCAGTTCTCCACCACTCCTCTCTCTGAAATTTTCAAG
GGTAAAAAGGTCGTCATATTTGGGCTTCCTGGTGCA
TTCACGGGAGTTTGTACAAGTCAGCATGTTCCAAGTTACAAGAAAAACATCGACAAGTTCAAGGCTAAAGGTGTTGATTCGGTTATCTGTGTGTCGGTTAATGATCCATACACCATGAAT
GGCTGGGCTGATAAGCTTGAAGCTAAAGATGCT
ATTGAATTCTACGGAGACTTTGATGGTAAATTTCACAAGAGCTTGGAGCTGGACTTAGATCTCAGTGCTGCATTGCTTGGACATCGC
TCAACTAG
ATGGTCGGCATTTGTGGAGGACGGCAAGGTTAAGGTTCTGAACGTCGAGAATGTTCCTTCTGACTTTAAGGTTTCCGGAGGTGAGGTAATCTTGGGGCAGATATAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CAGTAATCAC CGGCACATGG CGTACGCAGC GTTGAAACGA TCGTCAACAA TGAAGTCAAT GGCCACCAGA ATCGGTCAAT CATGGCGGCA GTTTGCTTCC GTTTCAGTCG GCAGCGATCT  CGTTGCAGCC GCTCCCAATG TTTCGCTCCA GAAGGCTCGA ACCTGGGACG AAGGTGTCTC GTCTCAGTTC TCCACCACTC CTCTCTCTGA AATTTTCAAG GGTAAAAAGG TCGTCATATT  TGGGCTTCCT GGTGCATTCA CGGGAGTTTG TACAAGTCAG CATGTTCCAA GTTACAAGAA AAACATCGAC AAGTTCAAGG CTAAAGGTGT TGATTCGGTT ATCTGTGTGT CGGTTAATGA  TCCATACACC ATGAATGGCT GGGCTGATAA GCTTGAAGCT AAAGATGCTA TTGAATTCTA CGGAGACTTT GATGGTAAAT TTCACAAGAG CTTGGAGCTG GACTTAGATC TCAGTGCTGC  ATTGCTTGGA CATCGCTCAA CTAGATGGTC GGCATTTGTG GAGGACGGCA AGGTTAAGGT TCTGAACGTC GAGAATGTTC CTTCTGACTT TAAGGTTTCC GGAGGTGAGG TAATCTTGGG 
GCAGATATAG AACAGTACTG CGAGGAAAGT AATGAATAAT TGGTTCAAAC TATGTTTGTA ACTTATGGGG AAGTAAATTG ACnATCATCA TCCCTTCCCC TGATGATACT TTTGGCTAC 

Retrieve as FASTA