Entry information : EcamPrx29 (EcC048378.10)
Entry ID 10283
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2012-02-03 (Qiang Li)
Sequence status partial
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EcamPrx29 (EcC048378.10)
Name (synonym) EcamPrx29 (EcC048378.10)
Class Class III peroxidase     [Orthogroup: Prx010]*
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx29
start..stop
S start..stop
EguPrx29 520 0 1..263 60..322
EgrPrx29 520 0 1..263 60..322
EglPrx29 519 0 1..263 60..322
EgrPrx25 505 0 1..263 57..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..48 48 N° 2 1468..1659 192 N° 3 1779..1944 166 N° 4 2035..2420 386
join(1..48,1468..1659,1779..1944,2035..2420)


exon

Literature and cross-references EcamPrx29 (EcC048378.10)
Protein sequence: EcamPrx29 (EcC048378.10)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   263
PWM (Da):   %s   27843.38  
PI (pH):   %s   5.55
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDGSLLRLHFHDCFVNGCDASILLDDTMNFTGEKTASANDNSIHGYEVIDTIKSQLESSCPGVVSCADILAVAARDSVVALGGPSWTVLLGRRDSTTASLSAANSDLPASTLSLSDLITAFSNKGFTAKEMVALSGSHTIGQARCTTFRTRLYNESDINDTFATSLKANCQSSGGDNNSSPLDTTSPTYFDNAYFKNLQTQKGLLHSDQQLFSGGSTDAHVNTYSSNSVTFMTDFANAMVKMGNLSPLTGSSGQIRKNCRKVN

Retrieve as FASTA  
Remarks Partial sequence from genomic. 5' end is missing. Incorrect prediction from kazusa.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACGGGTCGCTGCTCCGCCTTCACTTCCACGATTGCTTCGTCAATGCAAGTCCCTCTCCTCCGAGTCTCTCCTCTCTTTCCCATTGATTTCTACCTTTGTTTCTCTTCTGTCATTCA
AGCTGCATGCAATCGTGCGTGCATGATGCATCTTTATGCCTGTGCTTGTGAAACATTCCAACCACCCTCATAGTCAAAGGCATCATTAGATTTCGCTTCTACGCAATTAATGTACTCTCT
TTTTCGCTAACCAAAACACTAGGTACGAGATTCGCATAATGAAATAGTCGAGTCTGACTGACCTTTTTGGTATATTGTTGTGCCGTGCATTTTTGTGAGTTTATCAAGGGTGGACAAGAA
TGTTGTTGTGTATACTCTAATTTTTTTTTCATTACACAGACAATATATGCTATATTTTTCTTTATTATAAAAGCCATGCAGGCGACGTACTTTATGCTGATCTCGCTGTTGATAAGATGT
GCGTGTATGATTAGCTACCTGTTTTAAACCCGATTAACTCAATAATTTAGATCATGCAAAAGTCCTAAACGTTGCGGCTGGAAAAAGAGAGAGAGACGGGCCATGCTTTTTAAGTCAAAT
ACGCGTTTATCACGTTTGGCAAAACCAATCAGTCTTTCTCAATAGGTTTCAATTATATTTTGATCACCATCCCTTTGGTTGCCATGCTTTTCTAATTTAAAATGATATTTTATGGTAAAA
TATCAGTTTTAATGGAATTTGTTAATCCAATGGTATTCTAAAAATCATATTAGATCTTTGAATAAATGAATTGCGCCTTGTGCATGGCCTCACTAGTTTGCTTCCAACACAAAATATCAG
TTTGCATCCTAATGAACCTTTCTCCATCAAACATGCCGTCTCTACTTTGATCTTGATAGTCAAAGGCTGATCGATCTTTTAAATAACAAATATGACATGTTTACAATTATCTCCCTTAGA
TTTGTGGGTTGCTTTTCTTTTTCTTATATAGGTTGGAAATCGTCTAGATTTTCATTCTTAATCGATACATAATTGGTCATTCGAGAAGGCCAAGCTCAGGCTAATTCTAGTGAATCATAA
AGTCGGTTACTCCCCTGTTAAATATTAAAGAACGTGCCATGTTGCTAACCAAAAATCCTGATTTAGAGAACATTTCACAGCGCAATCATTTTGTTTCTAGTCCGACGATTATTGGATGCA
TTGTTCCATGAGAAACAACACGGAGTAAAGTCAGAAGGCATGAGAAAGAGTGTCACCCCCGTCCAAACTGGTGTCTCTAGTCGTTCATGGTAGGGGACAAAAAGGGGGAATGATAAGGGA
AACAACCAGTGTTTATGCTCTAATTTCAGGAAAATTTATAACACCCAAACCTCCTGCCTCCAACCAATGAATGAAATGAACGCCAATCGGATCGATTTTCCAATTAGAATGGCTGATTAA
TAATGTGTGGTGCAAAATATGAAACAGGGATGTGACGCGTCGATTTTGTTGGATGACACCATGAACTTCACCGGGGAGAAGACCGCCAGTGCGAATGACAATTCCATACATGGATACGAG
GTGATCGACACAATCAAGTCCCAACTGGAGAGCAGCTGCCCTGGGGTCGTGTCCTGTGCTGACATCTTGGCCGTCGCCGCGCGTGATTCTGTCGTTGCC
GTAAGTGGACATTTTCTTCTC
AACACTAGCGATCAATTGAGAGGAAAAAATCACATGCTATGTTACCCGTCTATATTAGCACTAACATGTTTGGATTTATTTGTTTATTTAATTTTCAGTTAGGTGGCCCAAGTTGGACAG
TCTTATTAGGAAGAAGAGACTCGACCACCGCAAGCCTAAGTGCTGCTAATAGCGACCTTCCTGCCTCAACTTTGAGCCTTAGTGACCTCATCACTGCCTTCTCAAACAAAGGCTTCACTG
CCAAAGAAATGGTGGCACTTTCAG
GTCAGTGTTTTTTTTTTTTTTTTTTGCATTTTATAATAAAGAATTATAATAAAGCTCGATTTACAAAAACTGTTCAATTGGTGTCCATAGGATCGC
ACACGATAGGTCAAGCCCGATGCACAACTTTCCGGACCCGACTTTATAATGAGAGCGACATCAACGACACGTTCGCAACATCACTAAAAGCAAACTGCCAGAGCTCTGGAGGTGACAACA
ATTCCTCTCCTCTCGACACCACGAGCCCGACATACTTCGACAACGCCTACTTCAAGAACTTGCAGACCCAAAAAGGGCTTCTTCACTCGGACCAGCAATTATTCAGTGGTGGTTCCACGG
ATGCTCATGTGAACACTTACAGTAGCAATTCGGTTACTTTCATGACAGATTTTGCTAACGCCATGGTGAAGATGGGTAACCTCAGCCCACTCACCGGCTCAAGCGGTCAGATTAGGAAGA
ACTGCAGGAAAGTCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGACGGGTCGCTGCTCCGCCTTCACTTCCACGATTGCTTCGTCAATGGATGTGACGCGTCGATTTTGTTGGATGACACCATGAACTTCACCGGGGAGAAGACCGCCAGTGCGAATGAC
AATTCCATACATGGATACGAGGTGATCGACACAATCAAGTCCCAACTGGAGAGCAGCTGCCCTGGGGTCGTGTCCTGTGCTGACATCTTGGCCGTCGCCGCGCGTGATTCTGTCGTTGCC
TTAGGTGGCCCAAGTTGGACAGTCTTATTAGGAAGAAGAGACTCGACCACCGCAAGCCTAAGTGCTGCTAATAGCGACCTTCCTGCCTCAACTTTGAGCCTTAGTGACCTCATCACTGCC
TTCTCAAACAAAGGCTTCACTGCCAAAGAAATGGTGGCACTTTCAG
GATCGCACACGATAGGTCAAGCCCGATGCACAACTTTCCGGACCCGACTTTATAATGAGAGCGACATCAACGAC
ACGTTCGCAACATCACTAAAAGCAAACTGCCAGAGCTCTGGAGGTGACAACAATTCCTCTCCTCTCGACACCACGAGCCCGACATACTTCGACAACGCCTACTTCAAGAACTTGCAGACC
CAAAAAGGGCTTCTTCACTCGGACCAGCAATTATTCAGTGGTGGTTCCACGGATGCTCATGTGAACACTTACAGTAGCAATTCGGTTACTTTCATGACAGATTTTGCTAACGCCATGGTG
AAGATGGGTAACCTCAGCCCACTCACCGGCTCAAGCGGTCAGATTAGGAAGAACTGCAGGAAAGTCAACTGA

Retrieve as FASTA