Entry information : EcamPrx95 (EcC049713.20)
Entry ID 10287
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2012-02-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-02-06 (Qiang Li)
Peroxidase information: EcamPrx95 (EcC049713.20)
Name (synonym) EcamPrx95 (EcC049713.20)
Class Class III peroxidase    [Orthogroup: Prx015]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx95
start..stop
S start..stop
EgrPrx95 653 0 1..318 1..318
EguPrx95 647 0 1..318 1..318
EglPrx95 647 0 1..318 1..318
MePrx114 522 0 17..317 19..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..207 207 N° 2 423..611 189 N° 3 760..922 163 N° 4 1121..1515 395
join(1..207,423..611,760..922,1121..1515)


exon

Literature and cross-references EcamPrx95 (EcC049713.20)
Protein sequence: EcamPrx95 (EcC049713.20)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   318 (296)
PWM (Da):   %s   34232.41 (32118.2) Transmb domain:   %s   i7-29o
PI (pH):   %s   8.73 (8.57) Peptide Signal:   %s   cut: 23 range:23-318
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRALAVVLGSAILLAYVASSAGALSLDYYDQTCPKLEYSVRGAVKKAMKNDNTVPAALLRMHFHDCFIRGCDGSVLLNSTAKNTAEKDGPPNISLHAFYVIDLAKEAVEAQCPGVVSCADILALAARDAVALSGGPHWDVPKGRKDGRISKANDTRQLPAPTFNISQLQQSFSQRGLSMEDLVALSGGHTLGFAHCSSFQNRIHNFNSVDDVDPSMHPSFAAQLRKVCPAHNKVRSAGSTLDPTVTKFDNVYYKMLLQGKSIFTSDQALLTVPKTKALVSKFAESQEEFEKAFVKSMIKMSSLSGGGQEIRLNCRVV

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from kazusa.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGAGCCCTTGCTGTTGTGCTCGGTTCTGCTATCTTGCTGGCGTATGTCGCGAGCAGTGCGGGTGCGCTGAGCTTGGATTACTATGACCAGACATGCCCGAAGCTCGAGTATTCGGTG
AGGGGGGCTGTGAAGAAAGCGATGAAGAACGACAACACCGTTCCTGCTGCTTTACTTCGCATGCACTTCCACGACTGCTTCATCAGA
GTAACTACTTGTTAATCCTTCACTCTCTGGTAA
AATTTTTTCCATGTGAGGTAGGGCTAGCTGTGTATGTTTTCGGCCTTCGTTAGTTCTCCTACGAAGACAAATGAAAAATGACTGCTTCTATGGAACAACTCGTCTCGACGAGACAGGAGT
AATTCAAGTTTGAACTTATAAGGCATTCATTGATGGTACTAAAGCTTTGATATTATTTCCAGGGATGTGACGGTTCCGTGCTCTTGAACTCGACGGCAAAGAACACAGCCGAAAAAGACG
GGCCGCCTAACATCTCACTCCACGCATTCTATGTGATCGACCTTGCGAAGGAAGCAGTGGAAGCTCAGTGCCCTGGGGTCGTCTCTTGCGCCGACATCTTGGCCTTGGCTGCTCGGGATG
CTGTCGCTCTG
GTGCTTTATGTTTTCCATATCCACTATAACTTACATTCACCTGCGTGTCATTGACATGTCCCGCAACATACGTGGTCAAAAGTTAACTCGCGCTACCTTGCGATTATTT
CTAATAATTCAGCATGGTTTTTCCTGATCTCCGTTGTAGTCTGGAGGACCGCATTGGGATGTGCCGAAAGGAAGAAAAGATGGGAGGATTTCGAAAGCGAATGACACAAGGCAATTACCA
GCTCCGACCTTCAACATCTCTCAACTACAGCAAAGCTTCTCTCAAAGAGGCCTTTCCATGGAAGACTTGGTGGCTCTCTCCG
GTACGAATATTCGCAAATTTTCATATGTATACACATGA
GCACTCCGCATTCATCACGCGTATGTGCATACGTACGCTGCGGCTTACATAAACTCATGCATTCATAGAAGTGGTCGAAACGTATAAGCCAGTATTCAACGGAAACGCCATCGCATACCC
TTTCGGGGATTAAGTACTGATATATGCGCCTCTGTTACAGGTGGTCACACCCTCGGTTTCGCCCACTGCTCGTCGTTCCAGAACCGGATCCACAACTTCAACTCTGTGGACGATGTCGAC
CCGTCGATGCACCCGTCCTTCGCGGCGCAGCTGCGGAAGGTGTGCCCGGCGCACAACAAAGTGAGGAGCGCGGGGTCCACGTTGGATCCCACGGTGACCAAATTCGACAACGTGTACTAC
AAGATGCTGCTCCAAGGGAAGAGCATCTTCACCTCGGATCAGGCGCTGCTCACCGTCCCGAAGACAAAAGCACTGGTCTCCAAGTTCGCCGAGAGCCAGGAGGAGTTCGAGAAGGCCTTC
GTGAAGTCCATGATCAAGATGAGCAGCTTGAGCGGCGGCGGGCAAGAGATTAGGCTGAATTGCAGAGTTGTTCGT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGAGCCCTTGCTGTTGTGCTCGGTTCTGCTATCTTGCTGGCGTATGTCGCGAGCAGTGCGGGTGCGCTGAGCTTGGATTACTATGACCAGACATGCCCGAAGCTCGAGTATTCGGTG
AGGGGGGCTGTGAAGAAAGCGATGAAGAACGACAACACCGTTCCTGCTGCTTTACTTCGCATGCACTTCCACGACTGCTTCATCAGA
GGATGTGACGGTTCCGTGCTCTTGAACTCGACG
GCAAAGAACACAGCCGAAAAAGACGGGCCGCCTAACATCTCACTCCACGCATTCTATGTGATCGACCTTGCGAAGGAAGCAGTGGAAGCTCAGTGCCCTGGGGTCGTCTCTTGCGCCGAC
ATCTTGGCCTTGGCTGCTCGGGATGCTGTCGCTCTG
TCTGGAGGACCGCATTGGGATGTGCCGAAAGGAAGAAAAGATGGGAGGATTTCGAAAGCGAATGACACAAGGCAATTACCAGCT
CCGACCTTCAACATCTCTCAACTACAGCAAAGCTTCTCTCAAAGAGGCCTTTCCATGGAAGACTTGGTGGCTCTCTCCG
GTGGTCACACCCTCGGTTTCGCCCACTGCTCGTCGTTCCAG
AACCGGATCCACAACTTCAACTCTGTGGACGATGTCGACCCGTCGATGCACCCGTCCTTCGCGGCGCAGCTGCGGAAGGTGTGCCCGGCGCACAACAAAGTGAGGAGCGCGGGGTCCACG
TTGGATCCCACGGTGACCAAATTCGACAACGTGTACTACAAGATGCTGCTCCAAGGGAAGAGCATCTTCACCTCGGATCAGGCGCTGCTCACCGTCCCGAAGACAAAAGCACTGGTCTCC
AAGTTCGCCGAGAGCCAGGAGGAGTTCGAGAAGGCCTTCGTGAAGTCCATGATCAAGATGAGCAGCTTGAGCGGCGGCGGGCAAGAGATTAGGCTGAATTGCAGAGTTGTTCGT

Retrieve as FASTA