Entry information : OsPrx20
Entry ID 1030
Creation 2006-07-17 (Filippo Passardi)
Last sequence changes 2006-07-17 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsPrx20
Name OsPrx20
Class Class III peroxidase    [Orthogroup: Prx003]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue types Leaves
Radicles
Roots
Seeds
Shoots
Inducer Drought
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx20
start..stop
S start..stop
ZmPrx16 497 4e-178 34..365 31..361
SiPrx06 474 3e-169 40..365 37..357
BdiPrx120 470 3e-167 35..365 33..361
TaPrx23-1D 467 3e-166 35..365 36..361
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 42421980..42422435 456 N° 2 42424085..42424726 642  
join(42421980..42422435,42424085..42424726)


exon

Literature and cross-references OsPrx20
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
Protein ref. UniProtKB:   Q5U1S3
DNA ref. GenBank:   NC_008394.1 (42421980..42424723)
Protein sequence: OsPrx20
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   365 (340)
PWM (Da):   %s   38343.7 (36071.5) Transmb domain:   %s   i7-29o
PI (pH):   %s   7.11 (7.12) Peptide Signal:   %s   cut: 26 range:26-365
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAAAAVVAVSVYLLVCSAPAAATAAAVAKKPSYPPVAKGLSFDHYKKSCPQAEAIVFSFLRDAIGKDVGLAAALIRLHFHDCFVQGCDASILLTKTPGGPDGEQQAIPNESLRPAAFKAVNDIRALLDRACGRVVSCSDIVTLAARDSVKLAGGPSYKVPLGRRDGLTSATPSQVLGALPPPTSHVPELIAALAKLNLDAADLIALSGAHTVGIAHCTSFTGRLYPKQDGTMDKWFAGQLKLTCPKNDTANTTVNDIRTPNAFDNKYYVDLQNRQGLFTSDQDLFVNATTRPLVAEFAVDQSAFFHQFVFSVVKMGQIQVLTGSQGQIRANCSVRNPGAASADEELPWSAAVETVVEAAESIVL*

Retrieve as FASTA  
Remarks chromosome 1. 39 ESTs (ubiquitous). Drought stress (leaf), rice blast fungus interaction, coleotile, prophyll.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCAGCAGCTGCGGTAGTAGCTGTATCTGTATACTTGCTGGTGTGCAGTGCTCCGGCGGCGGCGACGGCGGCGGCGGTGGCGAAGAAGCCGTCGTACCCGCCGGTGGCGAAGGGG
CTATCGTTCGACCACTACAAGAAGAGTTGCCCGCAGGCGGAGGCCATCGTGTTCAGCTTCCTGCGCGACGCCATCGGCAAGGACGTCGGCCTCGCCGCGGCGCTGATCCGGCTCCACTTC
CACGACTGCTTCGTCCAGGGCTGCGACGCCTCCATCCTCCTCACCAAGACGCCCGGCGGGCCCGACGGCGAGCAGCAGGCGATACCCAACGAGTCGCTGCGGCCGGCGGCGTTCAAGGCC
GTCAACGACATCCGCGCCCTGCTCGACAGGGCGTGCGGCCGCGTCGTCTCCTGCTCCGACATCGTCACCCTCGCCGCCCGCGATTCCGTCAAACTG
GTAACTAACTAAGTTAATTGATTA
ATTAATATTTTTTTCACTTACTTACTGCCACTGGAAAAGTTTTTCATGGAAGAGGAGATGGATTAAACACTACTGCTATCTAAAAAGTGGAGTTCATGAATAGAGGATAGGAAAATTAAC
TTAAGTAATGTGGGTTAGGATTCAAAATTTCCGAATGAAATTTTGGTCATATTAGACCATCCGATACCATACTATTTTAGCTAAATTTTTAATTTTTAATTTTTTTCATGAATTTTGGTA
ATATTTATTTAAATTTGAATAACATATTTTTAAAATTTCAAAAAATTTGAACCGAAATTTCGAAAATATCATCATATCGGCACCCGATACAGATACCGGAAACAAAAAGTCTGAACCCTG
ATGTGGGCACTGGCGCACTGCACGATGCTGCCGATGCACGAACTGTGTTTCATCCATCCATGATCCATGCATCTTGTTTCTCCAATTTTCTAGTATATCTCGATCTGGCAGCGGACAAGA
GACTTTCGTTGTCCGGTCCTAAATTAATCAACAGAAATGACCAAAGAACATCTTACAATATAATGATCATCCCTTTAAAATTCTCTTAATTAATTAAATACCCAACAATTAATTATGCAC
GCATCGAAAAACAAAGGGAAAAGAATCTACGCAGAGTTCTGCATGTTAGAAAAGACAATTCCCTTTAAGCTAGCCTTCTTTAGAGTGAAAGATATTTGGAGATCAATTTGCACGTAAATT
AATCTAATTAATTAAGCCATGTAACTGAGTAACAATTCCCTTGAAGAGCCATAGGAAACTATAACGCGGGATAATTGGACTGTCACGATCAGTACTTCTGTAGAATTTATTGGCTTGCGA
GAAATGGCACAAGAAGAACAAGATAGAGATGAAGGAAACAGGAAATTGTGTTGCTGTCTCAACCACGTGTGGAATCACTGTATCATGCCCAATGGCCAAAATTATCAGAACATCGACATC
TTAAATAATTAGGACGACTAATACGTGTAACAGATATTAATAAGACCATTTGCTGACTAGGAGTGTACCATCGATGTTCATTAACTAATTAATTATTTATTAATCAATTAGTCATTACAT
ATCATTTACTTGCTCTGTTCACGAATATAAACATTTTTAAGGAGTCAAAGCATGGATTAAGATTTAGATGAAATTGTTTTGATGACTAGAAATTTTACTAATAATGTTAAAAATACGTTT
TCTAAAAAAAATAATGAGATTAAAGATATGATATGGTCCCCATATCTTTGGACTTTGAGTATGTATTAGACTGTTATTAGCGTGGTGTTGTGTATGTTTGGTTTGTGCATGGTTACGGAT
GTGCCCGTGTAAATCAATAAATCTTAAAGGAGTAGTTGGACTGGAAAAGTGGTACGGAGTATTACATAAATGTTTGTTCTGGACAAATTTAATTAAACGTTAGAAATGTTTACGTCTGTG
CAAAGATAAATATTAATCAGTGAATGTTAGAACATACTCCCTCCGTTTCATAATGTAAGTCATTCTTTGATGCCCAATTCTTTGATGTAACCCCTACTCTATCAATATACAAGCAAAGCT
TTTACCCTCTTTTCAAGAAAAATAAATATAAAAACCAAAATGTTGAACATTGCAATTGGGTGCAGGCCGGTGGGCCGTCGTACAAGGTGCCGCTCGGCCGCCGTGACGGCCTCACATCGG
CGACGCCGTCACAGGTGCTGGGCGCGCTCCCGCCGCCGACCTCCCACGTCCCCGAGCTCATCGCCGCGCTGGCCAAGCTCAACCTCGACGCCGCCGACCTCATCGCGCTCTCCGGCGCCC
ACACCGTCGGCATCGCCCACTGCACCTCCTTCACCGGGCGGCTGTACCCGAAGCAGGACGGCACCATGGACAAGTGGTTCGCCGGCCAGCTCAAGCTGACGTGCCCGAAGAACGACACGG
CCAACACCACCGTCAACGACATCCGGACGCCCAACGCCTTCGACAACAAGTACTACGTCGACCTGCAAAACCGCCAGGGCCTCTTCACCTCCGACCAGGACCTCTTCGTCAACGCCACCA
CCAGGCCGCTCGTCGCCGAGTTCGCCGTCGACCAGTCGGCGTTCTTCCACCAGTTCGTCTTCTCCGTCGTCAAGATGGGCCAGATCCAGGTGCTCACCGGCTCGCAGGGACAGATCCGGG
CAAACTGCTCCGTCCGCAACCCCGGCGCCGCCTCCGCCGACGAGGAGCTCCCGTGGTCCGCCGCCGTGGAGACCGTCGTCGAGGCGGCCGAGAGCATCGTGCTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCAGCAGCTGCGGTAGTAGCTGTATCTGTATACTTGCTGGTGTGCAGTGCTCCGGCGGCGGCGACGGCGGCGGCGGTGGCGAAGAAGCCGTCGTACCCGCCGGTGGCGAAGGGG
CTATCGTTCGACCACTACAAGAAGAGTTGCCCGCAGGCGGAGGCCATCGTGTTCAGCTTCCTGCGCGACGCCATCGGCAAGGACGTCGGCCTCGCCGCGGCGCTGATCCGGCTCCACTTC
CACGACTGCTTCGTCCAGGGCTGCGACGCCTCCATCCTCCTCACCAAGACGCCCGGCGGGCCCGACGGCGAGCAGCAGGCGATACCCAACGAGTCGCTGCGGCCGGCGGCGTTCAAGGCC
GTCAACGACATCCGCGCCCTGCTCGACAGGGCGTGCGGCCGCGTCGTCTCCTGCTCCGACATCGTCACCCTCGCCGCCCGCGATTCCGTCAAACTG
GCCGGTGGGCCGTCGTACAAGGTG
CCGCTCGGCCGCCGTGACGGCCTCACATCGGCGACGCCGTCACAGGTGCTGGGCGCGCTCCCGCCGCCGACCTCCCACGTCCCCGAGCTCATCGCCGCGCTGGCCAAGCTCAACCTCGAC
GCCGCCGACCTCATCGCGCTCTCCGGCGCCCACACCGTCGGCATCGCCCACTGCACCTCCTTCACCGGGCGGCTGTACCCGAAGCAGGACGGCACCATGGACAAGTGGTTCGCCGGCCAG
CTCAAGCTGACGTGCCCGAAGAACGACACGGCCAACACCACCGTCAACGACATCCGGACGCCCAACGCCTTCGACAACAAGTACTACGTCGACCTGCAAAACCGCCAGGGCCTCTTCACC
TCCGACCAGGACCTCTTCGTCAACGCCACCACCAGGCCGCTCGTCGCCGAGTTCGCCGTCGACCAGTCGGCGTTCTTCCACCAGTTCGTCTTCTCCGTCGTCAAGATGGGCCAGATCCAG
GTGCTCACCGGCTCGCAGGGACAGATCCGGGCAAACTGCTCCGTCCGCAACCCCGGCGCCGCCTCCGCCGACGAGGAGCTCCCGTGGTCCGCCGCCGTGGAGACCGTCGTCGAGGCGGCC
GAGAGCATCGTGCTCTAG

Retrieve as FASTA