Entry information : EcamPrx71 (EcC052312.10)
Entry ID 10301
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2012-02-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EcamPrx71 (EcC052312.10)
Name (synonym) EcamPrx71 (EcC052312.10)
Class Class III peroxidase    [Orthogroup: Prx005]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx71
start..stop
S start..stop
EgrPrx71 663 0 1..327 1..327
EglPrx71 660 0 1..327 1..327
EguPrx71 622 0 1..327 1..327
EguPrx72 596 0 1..327 1..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..225 225 N° 2 610..795 186 N° 3 1238..1403 166 N° 4 1588..1994 407
join(1..225,610..795,1238..1403,1588..1994)


exon

Literature and cross-references EcamPrx71 (EcC052312.10)
Protein sequence: EcamPrx71 (EcC052312.10)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (300)
PWM (Da):   %s   35763.66 (32724.1)  
PI (pH):   %s   8.53 (8.70) Peptide Signal:   %s   cut: 28 range:28-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MACPKLFLSCLLLQLMFFFLVPEVAQGHGLKVGFYQKACPNAEAIVKEVIGQVLSIDPSLSGPILRLHFHDCFVRGCEGSVLLESPTYQSEKYAIRKLGLRGYQEIDRVKTALEKACPGIVSCADILALVTREIVVATGGLFYDVETGRRDGYVSILEEARRDLIPPSTNITTLKADFAKRGLSAKDLVVLSGGHTIGNSHCAAFSNRLYNFTGKGDADPTLDSNYIARLKLSCKPNDQTTLVEMDPGSARTFDIKYFDLILKRRGLFTSDAALLDDKETKAYLDFQIKTGGSTFFKDFGVSMVKMGRIGVLTKTAGEVRKVCTKVN

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from kazusa.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGTCCAAAGCTCTTCTTGTCTTGTTTGTTGCTTCAATTGATGTTCTTTTTTCTTGTCCCTGAGGTTGCTCAAGGTCACGGTCTCAAAGTAGGGTTTTACCAGAAGGCGTGCCCA
AACGCAGAGGCCATCGTGAAGGAAGTCATCGGCCAAGTCTTGTCCATCGATCCGAGTCTCTCCGGCCCTATTTTGAGGCTGCACTTTCACGATTGCTTCGTTAGG
GTAAGTAAGAGAGCG
AGCTCTCATGCTACTCTTCCCACTACGCGTTTGAAGTTTTACCATTTTCTTATAACTTGACTAGTTGCATGTAACTAAAGTTCGGATTCTAAGATGAGTAGTAATTGGCCAAAAAAAAAA
AAAAGAGGGTGAGAAGTTAGAACCTGGGCTTTCATCTGAAGGGGTAAAGCATGGCAGGGATGCATCAAGATTTACAAAATTGGCTTACCTGATAACAATATGATAAAATGGAAAATGGGT
ATTAGAACTAGTCATACCAGTAAATGGTATTCAGCTCTCAACGTACTTCGCTAGATTCGTCCATGGTTGCAAACTATTGTTTTCATGAACTCACGGTTGAATGATGCTTTGTTCTGGGCT
TTTCCACAGGGCTGTGAAGGTTCGGTGCTACTGGAGTCCCCGACCTATCAATCCGAGAAGTACGCGATTCGGAAGCTTGGCCTTCGAGGTTACCAAGAGATTGATAGAGTCAAAACAGCG
TTGGAGAAGGCATGCCCTGGCATCGTTTCGTGTGCTGACATCTTGGCCCTTGTCACTAGAGAGATTGTCGTCGCG
GTGCGCATATTCATAAATCACCTCCTCAATATTTTATCCTCAATT
TGATTGTGGAAAGCAAATTTTGGCCACACGTATCATAGAGGATAAGTACCCACAATTTATTTTTATTTTTTTAATGAGAAAAACATTTTTATATAGATATTGGGTTGTTTTTTCTTGTGT
TGTCGCTTTAGACCGGAGCACTTTTCTATGATTGGCCACACATATCATAGAGGATAAGTACCCACAATTTTTTTTTTTGAATGAGAAAAATATTTTTATATAGATATTGGAGTTTTTTGT
TTCTTGTGTTGTCGCTTTAGACCGGAGCACTTTTCTATGATTGGCCACACGTATCATAGAGGATAAGTACCCACAATTTATTTATTTATTTATTTTAATGAGAATAACATTTTTATATAG
ATATTGGAGTTCTTTGTTTCTTGTGTTGTCACTTTAGACCGGAGGACTTTTCTATGATGTGGAAACCGGACGAAGAGATGGGTACGTTTCTATTTTGGAGGAGGCACGTAGGGATTTAAT
ACCACCATCGACCAACATTACAACTCTGAAAGCAGATTTTGCAAAGAGAGGCCTTAGTGCAAAGGACCTTGTTGTCCTATCAG
GTAATACATAATCTCCAATTACTGCTTCACATGCTTT
GTCAAATATTTTGGAGAAATTAACGTAAGTTTATCAAGAAAAAGACCGTCATTTGAGCACGAGATACATGAACGTAATCAGCGGCACAGGGAGAAAATGTAATTTGTAACGTTAGATCAA
TGCCAATTCCAATTTCCAATTGACCAGGTGGGCACACCATTGGAAATTCACACTGCGCTGCCTTCTCCAACCGCCTCTACAACTTCACCGGAAAGGGCGACGCCGACCCCACGCTCGACT
CCAACTATATAGCAAGACTAAAGCTCAGTTGCAAGCCGAATGACCAAACCACTCTTGTCGAGATGGACCCGGGAAGTGCGAGAACGTTCGACATCAAATACTTCGATCTCATCCTGAAGA
GAAGAGGGCTCTTCACTTCGGACGCTGCACTTCTCGATGACAAAGAAACGAAGGCGTACCTTGACTTCCAGATCAAGACCGGTGGATCCACTTTCTTCAAGGACTTTGGAGTGTCGATGG
TGAAAATGGGTCGAATTGGCGTGCTCACCAAAACGGCTGGTGAAGTTAGAAAAGTGTGTACGAAGGTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGTCCAAAGCTCTTCTTGTCTTGTTTGTTGCTTCAATTGATGTTCTTTTTTCTTGTCCCTGAGGTTGCTCAAGGTCACGGTCTCAAAGTAGGGTTTTACCAGAAGGCGTGCCCA
AACGCAGAGGCCATCGTGAAGGAAGTCATCGGCCAAGTCTTGTCCATCGATCCGAGTCTCTCCGGCCCTATTTTGAGGCTGCACTTTCACGATTGCTTCGTTAGG
GGCTGTGAAGGTTCG
GTGCTACTGGAGTCCCCGACCTATCAATCCGAGAAGTACGCGATTCGGAAGCTTGGCCTTCGAGGTTACCAAGAGATTGATAGAGTCAAAACAGCGTTGGAGAAGGCATGCCCTGGCATC
GTTTCGTGTGCTGACATCTTGGCCCTTGTCACTAGAGAGATTGTCGTCGCG
ACCGGAGGACTTTTCTATGATGTGGAAACCGGACGAAGAGATGGGTACGTTTCTATTTTGGAGGAGGCA
CGTAGGGATTTAATACCACCATCGACCAACATTACAACTCTGAAAGCAGATTTTGCAAAGAGAGGCCTTAGTGCAAAGGACCTTGTTGTCCTATCAG
GTGGGCACACCATTGGAAATTCA
CACTGCGCTGCCTTCTCCAACCGCCTCTACAACTTCACCGGAAAGGGCGACGCCGACCCCACGCTCGACTCCAACTATATAGCAAGACTAAAGCTCAGTTGCAAGCCGAATGACCAAACC
ACTCTTGTCGAGATGGACCCGGGAAGTGCGAGAACGTTCGACATCAAATACTTCGATCTCATCCTGAAGAGAAGAGGGCTCTTCACTTCGGACGCTGCACTTCTCGATGACAAAGAAACG
AAGGCGTACCTTGACTTCCAGATCAAGACCGGTGGATCCACTTTCTTCAAGGACTTTGGAGTGTCGATGGTGAAAATGGGTCGAATTGGCGTGCTCACCAAAACGGCTGGTGAAGTTAGA
AAAGTGTGTACGAAGGTTAATTAA

Retrieve as FASTA