Entry information : EcamPrx75 (EcC052334.20)
Entry ID 10302
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2015-11-13 (Christophe Dunand)
Sequence status partial
Reviewer Achraf Jemmat
Last annotation changes 2015-11-13 (Achraf Jemmat)
Peroxidase information: EcamPrx75 (EcC052334.20)
Name (synonym) EcamPrx75 (EcC052334.20)
Class Class III peroxidase     [Orthogroup: Prx006]*
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx75
start..stop
S start..stop
EgrPrx75 681 0 1..331 3..333
EglPrx75 677 0 1..331 3..333
EguPrx75 676 0 1..331 3..333
PtrePrx01 631 0 1..331 3..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..231 231 N° 2 581..769 189 N° 3 1115..1280 166 N° 4 1434..1843 410
join(1..231,581..769,1115..1280,1434..1843)


exon

Literature and cross-references EcamPrx75 (EcC052334.20)
EST ref. GenBank:   FY793998.1 [5' end]
Protein sequence: EcamPrx75 (EcC052334.20)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331 (309)
PWM (Da):   %s   37212.23 (34899.9)  
PI (pH):   %s   8.39 (7.80) Peptide Signal:   %s   cut: 23 range:23-331
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
SKALIFLALLSFSAVSPRRAIAEINEEDKPGLVMNFYKDTCPQAEDIIKEQVKLLYKRHKNTAFSWLRNIFHDCAVESCDASLLLDSTRRSLSEKETDRSFGLRNFRYLDTIKEAVERECPGVVSCADILVLSARDGIVALGGPHFPLKTGRRDGRKSRADVVEQYLPDHNESISVVLDRFAAMGINTPGVVALLGAHSVGRTHCVKLVHRLYPEVDPVLNPDHIEHMLHKCPDAIPDPKAVQYVRNDRGTPMVLDNNYYRNILDNKGLLIVDHQLATDKRTKPYVKKMAKSQDYFFKEFARAITILSENNPLTGDQGEVRKQCNVANKHH

Retrieve as FASTA  
Remarks Partial sequence from genomic and EST. Only two first aa are missing. Incorrect prediction from kazusa. join(1..132,482..670,1016..1181,1335..1744)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TCCAAAGCTCTCATCTTCTTGGCTCTCTTATCTTTCTCAGCTGTGTCACCGAGACGTGCCATTGCAGAGATCAATGAGGAAGACAAGCCTGGTCTTGTGATGAACTTCTACAAGGACACC
TGCCCTCAAGCCGAGGATATCATCAAGGAGCAAGTGAAGCTCCTCTACAAGCGCCACAAGAATACTGCATTCTCCTGGCTGAGGAACATCTTCCATGACTGTGCTGTTGAG
GTATCAAAC
CTGCGTTGTGCTTAACGTCAGTTCTGCTCGATTGTTTTCAAGTTTAACGAGCAACATTTGTGTTTTTCTTGCAAAAGAAACAGCTTTTACGCTATCTTTCACTCATTTTCCAGTACTTTT
TTGCACTCGGGTTTGACCAATGAGCTTTATCTGGAGTCAAGAACCCAGATCTCCCTAGTGAGGCTTGGTCGAGCTAGCAAAATGAGAAATTATCAAATTCGATCTCTTAAGTTTTGGAAT
TGAGATTTAAGTTCAAGAAGTATACTATGTTGACTCAACTCAGCTCCTTTTTTGCGTTAGTGTTCGGAAACGTCATTTGCCTTGTGTGATGTGAATGCAGTCATGTGATGCTTCCCTGCT
CTTGGATTCGACTCGGAGGAGCTTGTCGGAGAAAGAAACCGACCGGAGTTTCGGTCTGAGGAACTTCAGGTACCTGGACACCATTAAAGAAGCTGTGGAGAGAGAATGCCCTGGAGTTGT
TTCTTGTGCGGACATCCTGGTCTTGTCTGCTAGAGATGGCATAGTCGCG
GTACTCACTCTTGTTGTTGTCCTAATTATGATGTTTGAGTATGAATATATAGAATCTGTAGATCTTTGCTT
CCTGTGTTTCTCTTTAATCTCTCTGTCGTATATGCTCTGTATATTTAATAACCCTTTCCTTTTGTTTTGAGTGAACAAAATATCTATCTGTACACTAGTCCTTTTGGCTAGTGTTTGCGA
AATCTGATAAATTCACATGTTTCCCCTGGGGATGAAGGTACCTCAACTCTGCCATATTTTACCCTTCTTTCTCAGTAACTCGTCAGCTTGTTCTCATATGGACTTTCAAGAAAATTGGTG
AAATCTGGTCTTGAAATTCACTCTCTCTGAGCAGCTAGGAGGCCCTCACTTTCCCCTGAAAACTGGGAGGAGAGATGGTAGGAAGAGCCGAGCTGATGTGGTCGAACAATACCTTCCAGA
TCACAATGAAAGCATTTCAGTGGTGCTCGACAGATTCGCGGCCATGGGCATCAACACACCAGGAGTGGTTGCTTTACTAG
GTAATTTACTATATGATCCTAGTGCTTCACCATCAGCTTT
ATTTTCCTAAAGTTGTTTAGCCTGCATATTGTAAAATCAGTATGCATGTTTGGTTATAATAATCTTAGTTGCTTGGTTGGTGCATCATTCTGTCTCCTGAATTTGTCTAACAGGAGCTCA
CAGCGTGGGCCGAACCCACTGCGTCAAGCTGGTTCACCGGCTCTATCCAGAGGTCGACCCTGTGCTGAACCCGGACCACATTGAGCACATGCTTCACAAGTGCCCAGATGCGATCCCAGA
CCCAAAGGCTGTGCAGTACGTGAGGAATGACAGAGGCACGCCGATGGTGCTGGACAACAATTACTACAGGAACATACTGGACAACAAGGGCTTGTTAATCGTGGACCACCAGCTTGCCAC
TGACAAGCGGACCAAGCCATATGTAAAGAAGATGGCCAAGAGCCAGGACTACTTCTTCAAGGAGTTTGCAAGGGCCATCACCATCCTCTCTGAGAACAACCCTCTCACTGGTGACCAAGG
TGAGGTCAGGAAGCAGTGCAATGTTGCTAACAAGCACCACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TCCAAAGCTCTCATCTTCTTGGCTCTCTTATCTTTCTCAGCTGTGTCACCGAGACGTGCCATTGCAGAGATCAATGAGGAAGACAAGCCTGGTCTTGTGATGAACTTCTACAAGGACACC
TGCCCTCAAGCCGAGGATATCATCAAGGAGCAAGTGAAGCTCCTCTACAAGCGCCACAAGAATACTGCATTCTCCTGGCTGAGGAACATCTTCCATGACTGTGCTGTTGAG
TCATGTGAT
GCTTCCCTGCTCTTGGATTCGACTCGGAGGAGCTTGTCGGAGAAAGAAACCGACCGGAGTTTCGGTCTGAGGAACTTCAGGTACCTGGACACCATTAAAGAAGCTGTGGAGAGAGAATGC
CCTGGAGTTGTTTCTTGTGCGGACATCCTGGTCTTGTCTGCTAGAGATGGCATAGTCGCG
CTAGGAGGCCCTCACTTTCCCCTGAAAACTGGGAGGAGAGATGGTAGGAAGAGCCGAGCT
GATGTGGTCGAACAATACCTTCCAGATCACAATGAAAGCATTTCAGTGGTGCTCGACAGATTCGCGGCCATGGGCATCAACACACCAGGAGTGGTTGCTTTACTAG
GAGCTCACAGCGTG
GGCCGAACCCACTGCGTCAAGCTGGTTCACCGGCTCTATCCAGAGGTCGACCCTGTGCTGAACCCGGACCACATTGAGCACATGCTTCACAAGTGCCCAGATGCGATCCCAGACCCAAAG
GCTGTGCAGTACGTGAGGAATGACAGAGGCACGCCGATGGTGCTGGACAACAATTACTACAGGAACATACTGGACAACAAGGGCTTGTTAATCGTGGACCACCAGCTTGCCACTGACAAG
CGGACCAAGCCATATGTAAAGAAGATGGCCAAGAGCCAGGACTACTTCTTCAAGGAGTTTGCAAGGGCCATCACCATCCTCTCTGAGAACAACCCTCTCACTGGTGACCAAGGTGAGGTC
AGGAAGCAGTGCAATGTTGCTAACAAGCACCACTAG

Retrieve as FASTA