Entry information : EcamPrx50 (EcC053631.10)
Entry ID 10304
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2012-02-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-10-30 (Qiang Li)
Peroxidase information: EcamPrx50 (EcC053631.10)
Name (synonym) EcamPrx50 (EcC053631.10)
Class Class III peroxidase    [Orthogroup: Prx057]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx50
start..stop
S start..stop
EgrPrx50 672 0 1..333 1..333
EglPrx52 672 0 1..333 1..333
EgrPrx52 671 0 1..333 1..333
EguPrx50 607 0 1..333 1..333
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..225 225 N° 2 334..525 192 N° 3 653..818 166 N° 4 1505..1923 419
join(1..225,334..525,653..818,1505..1923)


exon

Literature and cross-references EcamPrx50 (EcC053631.10)
Protein sequence: EcamPrx50 (EcC053631.10)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   333 (305)
PWM (Da):   %s   35519.77 (32778.3)  
PI (pH):   %s   5.06 (5.06) Peptide Signal:   %s   cut: 29 range:29-333
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAGSSTPSSLTAVTLLAALLLFLNPSNAQLTANFYAKTCPSVSSIVQTVIQEALQSEPRITASLLRLHFHDCFVDGCDGSLLLDNSPTIKSEKDAAPNFKSARGFDVVDKIKAAIESACPGTVSCADILALAAQASVSLSEGPYWTVLLGRRDSLTANQAGANTSIPSPIDSYNNLVSKFSAVGLDITDLATLSGAHTFGRAQCKSFNPRLYNFTANGGPDPTINPWYLTNLRKLCPQNGDSSVLADLDPTTPNLFDNHYYSNLQKIEGLLLSDQELYSTTGAATISIVNSFSFDQSAFFESFARSIVNMGNISPLTGSNGEIRFNCRKVNWS

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from kazusa.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGGTTCTTCTACTCCTTCCTCGCTGACGGCGGTGACCCTTCTCGCCGCATTGTTGTTGTTCCTCAATCCGTCGAACGCTCAACTGACTGCCAATTTTTATGCGAAGACATGCCCG
AGCGTGTCCAGTATTGTCCAAACCGTGATCCAGGAGGCCCTTCAATCTGAACCACGCATCACTGCCAGCCTCCTCCGTCTCCATTTCCACGATTGTTTCGTCGAC
GTGAGTCCCTAAGCT
AGATCAATTCCCATTAACAATGGTGCTCTCAATCTGATTACCAAGTAGCTAGTCACGCAACCTAATGTTTAAGCCTGACATGTGTGTTAAAAGGGGTGTGATGGATCGCTGCTGCTGGAC
AATAGCCCAACCATAAAGAGCGAGAAAGATGCAGCTCCGAATTTTAAGTCCGCAAGAGGGTTTGATGTCGTGGACAAGATCAAAGCGGCTATCGAGAGTGCTTGTCCAGGGACCGTGTCT
TGCGCCGACATTCTTGCCCTTGCTGCTCAAGCTTCCGTCTCTTTG
GTATATGTAGTTATAGTCAAAGAAACATAAACATAAATCTAAAGTATATTCGGGGTTCATTATTATAACTCACCC
TACTCAAACCATTATTGTATTTCTCTTGATTATCACTCTTACCAATTTGCAGTCAGAAGGTCCATATTGGACAGTGCTCTTGGGGAGGAGGGACAGCTTGACCGCGAACCAAGCCGGAGC
GAACACATCGATACCCTCCCCTATTGATAGCTATAACAACCTCGTTTCCAAATTCTCTGCTGTTGGCTTGGACATCACCGACCTTGCTACACTTTCCG
GTAAAAAAGAACAGTTACACTT
GCATTTTAATACGAAACGTGCAACCGTAGATATTGATGGACAAAAAAGATTTATAGAGTGAGATGCTGGATTTTTGTCACATAATTTATCGGCACAAACATCTCTTCACTTTTGTTTAAC
ACATTCTAACTTCCTAAGATGATCATGGTCTAATATTAATTGTAATCTATTGACATGCTTGTTAGGCCATGCACATCTACTAGAAGGAATTTTGGCTAAGGATTAAGGATCTCTTTTTTA
TTAATCTATAATTGAATAAGTAATTTGCCCTTGACTTGAGATCGATTGACATGTATGTGTTATGCCTAGGCCATGCTTGTATCGTGCATGGGCCGTGCACATCTACTAGAAGGAATTTTG
GCTAAGGATTAAGGATTTCTTTTTCATCACAAGAGTATGAATATCGGGAAAGATGGTATCAAAATTTGCAAACCCCTCATGTACTTATCTAAGAAATGCTAAGTTTACAGAATCAATATA
TTAAGTGATGTCGCGGATTATTATTACTTATTCATATATCCACTAATGAGTTTGCTGCATATGTTTGGCATACAAATTCCGTTGAGCATTCCTAGCATTGATCTATTCATCCATCTCCAT
AATTAAGCATCTGCAGATATTTGGTTCTCTTAGCTAACTTTTCCTGCATACGACAATAAAACAGGAGCTCACACCTTCGGACGTGCACAGTGCAAGTCATTCAACCCTAGGCTCTACAAC
TTCACCGCGAACGGTGGCCCTGATCCCACCATAAACCCGTGGTACTTGACCAATCTCCGGAAACTTTGCCCTCAGAATGGCGACAGTAGTGTCCTCGCCGACCTCGACCCGACAACCCCA
AACTTGTTTGACAACCACTACTACTCCAACCTCCAGAAAATTGAAGGGCTTCTTCTGTCCGATCAAGAGCTGTACTCCACAACTGGCGCCGCAACAATTTCCATCGTCAACAGCTTTAGC
TTTGACCAGAGTGCCTTCTTCGAGAGCTTCGCTCGGTCGATAGTAAACATGGGAAATATTAGTCCTCTCACCGGAAGTAACGGGGAGATCCGGTTCAATTGTAGGAAGGTCAATTGGAGT
TGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGGTTCTTCTACTCCTTCCTCGCTGACGGCGGTGACCCTTCTCGCCGCATTGTTGTTGTTCCTCAATCCGTCGAACGCTCAACTGACTGCCAATTTTTATGCGAAGACATGCCCG
AGCGTGTCCAGTATTGTCCAAACCGTGATCCAGGAGGCCCTTCAATCTGAACCACGCATCACTGCCAGCCTCCTCCGTCTCCATTTCCACGATTGTTTCGTCGAC
GGGTGTGATGGATCG
CTGCTGCTGGACAATAGCCCAACCATAAAGAGCGAGAAAGATGCAGCTCCGAATTTTAAGTCCGCAAGAGGGTTTGATGTCGTGGACAAGATCAAAGCGGCTATCGAGAGTGCTTGTCCA
GGGACCGTGTCTTGCGCCGACATTCTTGCCCTTGCTGCTCAAGCTTCCGTCTCTTTG
TCAGAAGGTCCATATTGGACAGTGCTCTTGGGGAGGAGGGACAGCTTGACCGCGAACCAAGCC
GGAGCGAACACATCGATACCCTCCCCTATTGATAGCTATAACAACCTCGTTTCCAAATTCTCTGCTGTTGGCTTGGACATCACCGACCTTGCTACACTTTCCG
GAGCTCACACCTTCGGA
CGTGCACAGTGCAAGTCATTCAACCCTAGGCTCTACAACTTCACCGCGAACGGTGGCCCTGATCCCACCATAAACCCGTGGTACTTGACCAATCTCCGGAAACTTTGCCCTCAGAATGGC
GACAGTAGTGTCCTCGCCGACCTCGACCCGACAACCCCAAACTTGTTTGACAACCACTACTACTCCAACCTCCAGAAAATTGAAGGGCTTCTTCTGTCCGATCAAGAGCTGTACTCCACA
ACTGGCGCCGCAACAATTTCCATCGTCAACAGCTTTAGCTTTGACCAGAGTGCCTTCTTCGAGAGCTTCGCTCGGTCGATAGTAAACATGGGAAATATTAGTCCTCTCACCGGAAGTAAC
GGGGAGATCCGGTTCAATTGTAGGAAGGTCAATTGGAGTTGA

Retrieve as FASTA