Entry information : OsPrx21
Entry ID 1031
Creation 2006-07-17 (Filippo Passardi)
Last sequence changes 2006-07-17 (Filippo Passardi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-08-03 (Marie Brette (Scipio))
Peroxidase information: OsPrx21
Name OsPrx21
Class Class III peroxidase    [Orthogroup: Prx003]
Taxonomy Viridiplantae (green plants); Streptophyta; Angiospermae; Monocotyledons
Organism Oryza sativa ssp japonica cv Nipponbare    [TaxId: 39947 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value OsPrx21
start..stop
S start..stop
OsPrx20 398 3e-139 32..333 34..337
SbPrx69 397 7e-139 21..336 18..340
BdiPrx120 395 4e-138 33..335 33..338
OsPrx22 394 1e-137 33..338 30..337
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 42428947..42429192 246 N° 2 42429405..42430178 774  
join(42428947..42429192,42429405..42430178)


exon

Literature and cross-references OsPrx21
Literature Passardi F., Longet, D., Penel C. and Dunand, C. The class III peroxidase multigenic family in rice and its evolution in land plants Phytochemistry, 65 (13), 1879-1893 (2004)
DNA sequence http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=nucleotide&cmd=search&term=BN000550&doptcmdl=GenBank
Protein ref. UniProtKB:   Q94DM4
DNA ref. GenBank:   NC_008394.1 (42428947..42430175)
Protein sequence: OsPrx21
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   339 (310)
PWM (Da):   %s   35980.51 (33033.0) Transmb domain:   %s   i7-29o
PI (pH):   %s   8.62 (8.57) Peptide Signal:   %s   cut: 30 range:30-339
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARKMSSTLQVLVVSCCSLLLLCAPAASAGDYPPTAKGLSYGFYQRSCPKAETIVRSFLKKAIRNDVGLAPGLIRLHFHDCFGCDASVLLARTATEASELDAPPNETIRPSALMAVAQLRALLDDACSGAVVSCADILTLAARDSVRLVGGPEYRVPLGRRDGATIAARERVVAAFPPPSSNVTALLAAVAKIGLDAADLVALSGAHTLGVSRCISFDDRLFPQVDATMDARFAAHLRLSCPAKNTTNTTAIDVRTPNAFDNKYYVDLLSRQGLLTSDQVLFSDGRTRGLVGRFAVDQPEFFRRFAFSMVKMSQIQVMTGVQGEIRTNCSVRNAAGGGT*

Retrieve as FASTA  
Remarks chromosome 1; no ESTs (NIAS DNA database and TIGR)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAGAAAAATGAGCAGCACGTTGCAGGTTTTGGTCGTTTCCTGCTGCAGCTTGCTGCTTCTGTGTGCTCCGGCGGCCTCCGCCGGCGATTACCCGCCGACGGCGAAGGGCTTGTCG
TACGGTTTCTACCAGAGGAGCTGTCCCAAGGCGGAGACCATCGTGAGGAGCTTCCTCAAGAAGGCCATCCGCAACGACGTCGGCCTCGCCCCCGGCCTCATCCGTCTCCACTTCCATGAC
TGCTTC
GTCCAGGCAATTAACTAATTGATTAAAATTAATTGATTATACACCTAATCATGCATAATGCATGTGCAAAATGATGAAATTACGCCTCAAACATGCTCTGAATTTTGAATTCTG
GATTGAACAGATCGATCGATACTATATTTAAACACGCATCTGTGACGGGTAATTATTCGCGAACCGCCACTAATAATTGTGCTGCGCTGTGCGTGCAGGGTTGCGACGCGTCGGTGCTGT
TGGCGCGCACGGCGACGGAGGCGAGCGAGCTGGACGCTCCACCCAACGAGACCATCCGCCCGTCGGCGTTGATGGCCGTCGCCCAACTCCGCGCCCTGCTCGACGACGCGTGCAGCGGGG
CCGTCGTCTCCTGCGCTGACATCCTCACCCTCGCCGCGCGCGACTCCGTCCGCCTGGTCGGCGGGCCGGAGTACAGGGTCCCCCTGGGCCGGCGCGACGGCGCGACGATCGCGGCGAGGG
AGCGCGTCGTCGCCGCGTTCCCGCCGCCGAGCTCCAACGTGACGGCGCTCCTCGCCGCCGTGGCCAAGATCGGCCTCGACGCCGCCGACCTCGTGGCGCTCTCCGGCGCGCACACGCTCG
GCGTCTCCCGCTGCATCTCCTTCGACGACCGCCTCTTCCCGCAGGTGGACGCCACCATGGACGCGCGGTTCGCCGCCCACCTCAGGCTCTCCTGCCCGGCCAAGAACACCACCAACACCA
CCGCCATCGACGTACGGACGCCCAACGCCTTCGACAACAAGTACTACGTCGACCTGCTCAGCCGGCAGGGGCTCCTGACCTCCGATCAGGTGCTGTTCAGCGACGGCAGGACGAGGGGCC
TCGTCGGCAGGTTCGCCGTCGACCAGCCGGAGTTCTTCCGCCGCTTCGCCTTCTCCATGGTGAAGATGTCGCAGATCCAGGTGATGACGGGAGTGCAGGGGGAGATCCGCACCAACTGCT
CGGTGCGCAACGCCGCCGGCGGTGGCACCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAGAAAAATGAGCAGCACGTTGCAGGTTTTGGTCGTTTCCTGCTGCAGCTTGCTGCTTCTGTGTGCTCCGGCGGCCTCCGCCGGCGATTACCCGCCGACGGCGAAGGGCTTGTCG
TACGGTTTCTACCAGAGGAGCTGTCCCAAGGCGGAGACCATCGTGAGGAGCTTCCTCAAGAAGGCCATCCGCAACGACGTCGGCCTCGCCCCCGGCCTCATCCGTCTCCACTTCCATGAC
TGCTTC
GGTTGCGACGCGTCGGTGCTGTTGGCGCGCACGGCGACGGAGGCGAGCGAGCTGGACGCTCCACCCAACGAGACCATCCGCCCGTCGGCGTTGATGGCCGTCGCCCAACTCCGC
GCCCTGCTCGACGACGCGTGCAGCGGGGCCGTCGTCTCCTGCGCTGACATCCTCACCCTCGCCGCGCGCGACTCCGTCCGCCTGGTCGGCGGGCCGGAGTACAGGGTCCCCCTGGGCCGG
CGCGACGGCGCGACGATCGCGGCGAGGGAGCGCGTCGTCGCCGCGTTCCCGCCGCCGAGCTCCAACGTGACGGCGCTCCTCGCCGCCGTGGCCAAGATCGGCCTCGACGCCGCCGACCTC
GTGGCGCTCTCCGGCGCGCACACGCTCGGCGTCTCCCGCTGCATCTCCTTCGACGACCGCCTCTTCCCGCAGGTGGACGCCACCATGGACGCGCGGTTCGCCGCCCACCTCAGGCTCTCC
TGCCCGGCCAAGAACACCACCAACACCACCGCCATCGACGTACGGACGCCCAACGCCTTCGACAACAAGTACTACGTCGACCTGCTCAGCCGGCAGGGGCTCCTGACCTCCGATCAGGTG
CTGTTCAGCGACGGCAGGACGAGGGGCCTCGTCGGCAGGTTCGCCGTCGACCAGCCGGAGTTCTTCCGCCGCTTCGCCTTCTCCATGGTGAAGATGTCGCAGATCCAGGTGATGACGGGA
GTGCAGGGGGAGATCCGCACCAACTGCTCGGTGCGCAACGCCGCCGGCGGTGGCACCTAG

Retrieve as FASTA