Entry information : EcamPrx86 (EcC054753.60)
Entry ID 10325
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2015-11-13 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-13 (Achraf Jemmat)
Peroxidase information: EcamPrx86 (EcC054753.60)
Name (synonym) EcamPrx86 (EcC054753.60)
Class Class III peroxidase    [Orthogroup: Prx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx86
start..stop
S start..stop
EglPrx86 645 0 3..313 27..337
EgrPrx86 643 0 3..313 27..337
EguPrx86 630 0 3..313 27..337
EgrPrx75 591 0 4..313 24..333
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..177 177 N° 2 365..553 189 N° 3 1193..1358 166 N° 4 1508..1914 407
join(1..177,365..553,1193..1358,1508..1914)


exon

Literature and cross-references EcamPrx86 (EcC054753.60)
EST ref. GenBank:   FY794127.1 [5' end]   FY794128.1 [3' end]
Protein sequence: EcamPrx86 (EcC054753.60)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   313
PWM (Da):   %s   35323.98  
PI (pH):   %s   7.52
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQEGEGEAEVGSGLVIDFYKDTCPQAEDIIKEQVKLLYKRHKNTAFSWLRNIFHDCAVQSCDASLLLDSTRRDLSEKETDRSFGMRNFRYLDTIKEAVERECPGVVSCADILVLSARDGVVALGGPHIPLKTGRRDGRRSRADVIEEHLPDHNESMSVVLERFAKMGIDTPGVVALLGAHSVGRTHCVKLVQRLYPEVDPALNPDHVEHMLYKCPDPIPDPKAVQYVRNDRGTPMIFDNNYYRNILDNKGLLLVDHQLAVDKRTKPYVKKMAKSQNYFFKEFARALTILSENNPLTGDKGEIRRQCNVANKH

Retrieve as FASTA  
Remarks Complete sequence from genomic and EST. Incorrect prediction from kazusa (short PS is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAAGAGGGTGAGGGTGAGGCTGAGGTAGGGTCTGGCCTGGTGATAGACTTCTACAAGGACACTTGTCCTCAGGCTGAGGACATCATTAAAGAGCAAGTCAAGCTTCTCTACAAGCGC
CACAAGAACACTGCATTCTCTTGGCTTAGGAACATCTTCCATGACTGTGCTGTTCAA
GTGAGCTAGCTTTCCTTCCATTTGCTTATCTGTCTTTTCTTTTCGTATTTCTTTCCAAGAATT
TAAGTTAAAGGTGTTGCAGTCTTGTTCATCTTTCTTTGCCCTTTTCTTTTTACCCAAAGAAATGCTGCCTTCTGAAGCTAAAGTTTTGATCCTTTCACTGTTTGGGCATGTGGGTGTTGC
ACAGTCTTGCGATGCTTCATTGCTCCTGGACTCAACAAGGAGGGATCTCTCTGAGAAAGAGACGGACAGGAGCTTTGGGATGAGGAACTTCAGGTACCTCGACACCATCAAGGAGGCTGT
GGAGAGAGAATGTCCTGGAGTTGTTTCTTGTGCAGACATTCTGGTGTTGTCTGCTAGAGATGGCGTTGTTGCG
GTACTTATGAATCTTTCACCCTCCAGATTATTAATTTTCCTCTCCTG
CATGTGGTGTTCGTGTCATTTCCTAGACTGCATCTGTTTCACAGATGCGAAAACAGATGCGACTTATAAAAAGATTTTCAAATGGGTCTAGTTCATGACATTCTATGATCTTTTGCTGAC
TCTGTAATATAAAAAGAAGAAGAAGAAGAAGAAGACAATAGTAGATATTTCAAGGACATTTTCCATTTCTGGGAAGAAAATCTAGTTGTGATTGATCCCTTCCAGTTCCTACTTCGGGAG
GTATCATGCCAGTACTACCCTAGATATGGCAAATTTTCCATTTTTGACCTTGATCTCACTACCCTTTTCTTGAATTAAATGCTCTTTTGACTCATAACTGCAACAACTATTTCATTACTG
GCCAAACAAACCAGAAAACTTATCACAGGATTTCCAGTTTCAGCTTTAGGGAGGATTTGATTATAAGAATAAAAAAGGACAGCTGCATGAACTTCAGATCTTACTGATGAGGGTTTAACT
GTTTAGCAAAAAATGAGGGGAAAAAGAAAACCAATGGGCTTCATTAAATCTAAGCAAATCTGGCATAAATCTGTTCTCTAAACTCTAAAAGCTATATTCTTTTCCTCACCAGCTAGGAGG
CCCTCATATTCCTCTGAAAACTGGAAGAAGAGATGGCAGGAGGAGCAGAGCAGATGTCATTGAGGAACACTTGCCAGACCACAACGAGAGCATGTCTGTTGTGCTTGAAAGATTTGCAAA
GATGGGCATTGATACTCCTGGAGTGGTTGCCTTGCTCG
GTACTTTCATTTGGTGCTTCTTGAATTAATTCTAAGCTTCTGACTAGTGTCTGAATTAAAGCGTTCATACTCAACCCAAATC
CATTCTCACTGGAGTCCGTTGCCTGCAATTGATGGAGTCTAACAATGTCTTATATTGCATCTAACAGGAGCACACAGCGTGGGCCGAACCCACTGCGTCAAGCTGGTTCAGCGGCTATAC
CCTGAGGTTGACCCAGCCCTCAATCCCGACCATGTGGAGCACATGCTCTACAAGTGCCCGGACCCAATCCCTGACCCAAAGGCCGTGCAGTACGTGAGGAACGACCGTGGCACCCCCATG
ATATTCGACAACAACTATTACAGGAACATATTGGACAACAAGGGCTTGCTCCTGGTGGATCACCAGCTAGCCGTCGATAAGAGGACCAAGCCCTATGTGAAGAAGATGGCCAAGAGCCAA
AACTACTTCTTCAAGGAATTCGCCAGAGCCCTCACCATCCTTTCTGAGAACAACCCGCTTACCGGAGACAAGGGTGAGATCAGGAGGCAATGCAACGTTGCCAACAAACACCAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAAGAGGGTGAGGGTGAGGCTGAGGTAGGGTCTGGCCTGGTGATAGACTTCTACAAGGACACTTGTCCTCAGGCTGAGGACATCATTAAAGAGCAAGTCAAGCTTCTCTACAAGCGC
CACAAGAACACTGCATTCTCTTGGCTTAGGAACATCTTCCATGACTGTGCTGTTCAA
TCTTGCGATGCTTCATTGCTCCTGGACTCAACAAGGAGGGATCTCTCTGAGAAAGAGACGGAC
AGGAGCTTTGGGATGAGGAACTTCAGGTACCTCGACACCATCAAGGAGGCTGTGGAGAGAGAATGTCCTGGAGTTGTTTCTTGTGCAGACATTCTGGTGTTGTCTGCTAGAGATGGCGTT
GTTGCG
CTAGGAGGCCCTCATATTCCTCTGAAAACTGGAAGAAGAGATGGCAGGAGGAGCAGAGCAGATGTCATTGAGGAACACTTGCCAGACCACAACGAGAGCATGTCTGTTGTGCTT
GAAAGATTTGCAAAGATGGGCATTGATACTCCTGGAGTGGTTGCCTTGCTCG
GAGCACACAGCGTGGGCCGAACCCACTGCGTCAAGCTGGTTCAGCGGCTATACCCTGAGGTTGACCCA
GCCCTCAATCCCGACCATGTGGAGCACATGCTCTACAAGTGCCCGGACCCAATCCCTGACCCAAAGGCCGTGCAGTACGTGAGGAACGACCGTGGCACCCCCATGATATTCGACAACAAC
TATTACAGGAACATATTGGACAACAAGGGCTTGCTCCTGGTGGATCACCAGCTAGCCGTCGATAAGAGGACCAAGCCCTATGTGAAGAAGATGGCCAAGAGCCAAAACTACTTCTTCAAG
GAATTCGCCAGAGCCCTCACCATCCTTTCTGAGAACAACCCGCTTACCGGAGACAAGGGTGAGATCAGGAGGCAATGCAACGTTGCCAACAAACACCAC

Retrieve as FASTA