Entry information : EcamPrx144 (EcC054805.300)
Entry ID 10326
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2012-02-03 (Qiang Li)
Sequence status partial
Reviewer Qiang Li
Last annotation changes 2013-02-06 (Qiang Li)
Peroxidase information: EcamPrx144 (EcC054805.300)
Name (synonym) EcamPrx144 (EcC054805.300)
Class Class III peroxidase     [Orthogroup: Prx014]*
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx144
start..stop
S start..stop
EgrPrx144 611 0 1..306 20..325
EguPrx144 607 0 1..306 20..325
RcPrx36 511 0 2..306 22..326
MePrx28 499 2e-180 1..306 21..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..366 366 N° 2 471..636 166 N° 3 778..1163 386  
join(1..366,471..636,778..1163)


exon

Literature and cross-references EcamPrx144 (EcC054805.300)
Protein sequence: EcamPrx144 (EcC054805.300)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   306 (290)
PWM (Da):   %s   32460.09 (30742.3)  
PI (pH):   %s   7.26 (7.25) Peptide Signal:   %s   cut: 17 range:17-306
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLVLLCMSCHAQLSSTFYDESCPDALATIRTSIRTAVSRERRMAASLIRLHFHDCFVQGCDASILLENSPTISSERDAGPNKGSVRGYEVIDDAKSEVEKICPGVVSCADIVAVAARDASVAVGSPSWTVKLGRRDSTTASPSLASSDLPSFQDGLETLVSRFASKGLSARDMVALSGAHTLGQAQCFTFRDRIYSNGSDIDAGFASTRKRRCPASGGDATLAPLDLVTPNSFDNNYFKNLMQKKGLLESDQVLFSGGSTDSIVSDYSKKPASFKSDFAAAMIKMGDISPLTGSSGQIRRICSAL

Retrieve as FASTA  
Remarks Partial sequence from genomic. Incorrect prediction from kazusa (3' end is missing due to the NNNNN).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTAGTGCTCCTGTGCATGTCCTGCCATGCGCAGCTTTCCTCCACGTTTTACGATGAGTCATGCCCCGATGCCCTCGCCACGATTCGGACTTCCATCAGAACCGCAGTCTCGAGGGAG
CGCCGGATGGCTGCTTCTCTCATCCGACTCCATTTCCACGATTGCTTCGTCCAGGGTTGCGATGCGTCGATACTGCTAGAGAATAGCCCCACCATCTCTAGTGAGAGAGACGCAGGGCCG
AACAAAGGCTCCGTGAGAGGTTATGAGGTGATTGACGACGCCAAGTCGGAAGTGGAGAAGATCTGTCCAGGAGTTGTGTCTTGTGCGGATATTGTTGCCGTCGCAGCTCGAGATGCTTCT
GTTGCC
GTAAGTCTTCCCATAGTTCTCAAGATATGCATCTTATGATCACTTGATTACTTTCAAATATCGACTATGAGTTTAAATCATTTTCCTTACTGACAAAAATGTAGGTTGGCAGTC
CTTCTTGGACGGTGAAGCTCGGAAGAAGAGACTCGACCACCGCAAGCCCATCGCTCGCGTCAAGCGATCTTCCATCGTTTCAAGATGGCCTTGAGACACTCGTATCTCGATTTGCAAGCA
AGGGCCTTAGTGCTAGAGACATGGTTGCCCTCTCAG
GTATATACGAAATGCTTATTCAAACCTGACGATAGAGCTTGGCCTATGCAAGAATTTCTCATTCTTGCTCACAAGCTCGAATGA
TATTGAATAAAAGGGAAAAATAATGTTGATGTGCCCTTTTCTGCCAACGTTACGCAGGTGCTCACACTCTAGGGCAAGCTCAGTGCTTCACGTTCAGGGACAGGATCTACAGCAACGGCA
GCGACATCGACGCGGGATTCGCCAGCACCCGTAAGCGCCGGTGCCCGGCAAGCGGCGGCGATGCCACTCTAGCCCCACTCGATTTGGTGACCCCCAATTCATTCGACAACAACTACTTCA
AGAATCTGATGCAGAAGAAAGGCCTCCTCGAGTCGGACCAAGTCCTTTTCAGCGGAGGTTCCACCGACAGCATCGTCTCCGATTACAGCAAGAAGCCCGCAAGCTTCAAGTCGGATTTTG
CGGCTGCCATGATTAAGATGGGCGACATAAGTCCGCTCACCGGTTCAAGTGGCCAGATCAGGAGGATTTGCAGTGCTCTAAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTAGTGCTCCTGTGCATGTCCTGCCATGCGCAGCTTTCCTCCACGTTTTACGATGAGTCATGCCCCGATGCCCTCGCCACGATTCGGACTTCCATCAGAACCGCAGTCTCGAGGGAG
CGCCGGATGGCTGCTTCTCTCATCCGACTCCATTTCCACGATTGCTTCGTCCAGGGTTGCGATGCGTCGATACTGCTAGAGAATAGCCCCACCATCTCTAGTGAGAGAGACGCAGGGCCG
AACAAAGGCTCCGTGAGAGGTTATGAGGTGATTGACGACGCCAAGTCGGAAGTGGAGAAGATCTGTCCAGGAGTTGTGTCTTGTGCGGATATTGTTGCCGTCGCAGCTCGAGATGCTTCT
GTTGCC
GTTGGCAGTCCTTCTTGGACGGTGAAGCTCGGAAGAAGAGACTCGACCACCGCAAGCCCATCGCTCGCGTCAAGCGATCTTCCATCGTTTCAAGATGGCCTTGAGACACTCGTA
TCTCGATTTGCAAGCAAGGGCCTTAGTGCTAGAGACATGGTTGCCCTCTCAG
GTGCTCACACTCTAGGGCAAGCTCAGTGCTTCACGTTCAGGGACAGGATCTACAGCAACGGCAGCGAC
ATCGACGCGGGATTCGCCAGCACCCGTAAGCGCCGGTGCCCGGCAAGCGGCGGCGATGCCACTCTAGCCCCACTCGATTTGGTGACCCCCAATTCATTCGACAACAACTACTTCAAGAAT
CTGATGCAGAAGAAAGGCCTCCTCGAGTCGGACCAAGTCCTTTTCAGCGGAGGTTCCACCGACAGCATCGTCTCCGATTACAGCAAGAAGCCCGCAAGCTTCAAGTCGGATTTTGCGGCT
GCCATGATTAAGATGGGCGACATAAGTCCGCTCACCGGTTCAAGTGGCCAGATCAGGAGGATTTGCAGTGCTCTAAAT

Retrieve as FASTA