Entry information : EcamPrx146 (EcC055146.20)
Entry ID 10327
Creation 2012-01-30 (Qiang Li)
Last sequence changes 2012-02-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2013-02-06 (Qiang Li)
Peroxidase information: EcamPrx146 (EcC055146.20)
Name (synonym) EcamPrx146 (EcC055146.20)
Class Class III peroxidase    [Orthogroup: Prx031]
Taxonomy Eukaryota Viridiplantae Streptophyta Myrtaceae Eucalyptus
Organism Eucalyptus camaldulensis    [TaxId: 34316 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value EcamPrx146
start..stop
S start..stop
EgrPrx146 645 0 1..323 1..323
EguPrx146 615 0 1..323 1..323
EglPrx146 593 0 1..323 1..319
EguPrx62 455 4e-162 1..320 4..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..219 219 N° 2 338..517 180 N° 3 631..790 160 N° 4 881..1290 410
join(1..219,338..517,631..790,881..1290)


exon

Literature and cross-references EcamPrx146 (EcC055146.20)
Protein sequence: EcamPrx146 (EcC055146.20)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (299)
PWM (Da):   %s   33879.74 (31555.5) Transmb domain:   %s   i7-29o
PI (pH):   %s   9.16 (9.13) Peptide Signal:   %s   cut: 25 range:25-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSTGSRLALALALVLSTIAPPCSAALRAGFYKGKCGLVDVESVVATIVASRFSRDPSIVAALLRLQFHDCFVNGCDASILLDGSSSEKTAGPNLSVRGYDLIDAAKAAVEAICPGVVSCADIIVMATRDAVALAKGGRYSVQTGRLDGKISLAQNVNLPGPSMTVSQAASAFARKGFTVSDMVILLGGHTVGITHCSLFQDRLYNFNGLGKPDPTMDPKLVAALRPRCPQTATIDNTVNLDQNSSSALVVDNSFYKQIVARRGILQIDQELALDRLSKSLVATLANATNFSARFGLAMVKLGALQSRLPGEIRSSCRAINKR

Retrieve as FASTA  
Remarks Complete sequence from genomic. Correct prediction from kazusa.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGACGGGAAGTAGATTGGCGTTGGCCCTCGCTCTCGTCCTCTCGACCATCGCGCCCCCATGCTCCGCCGCTCTCCGGGCAGGGTTCTACAAAGGCAAGTGTGGCCTCGTGGATGTC
GAGTCCGTGGTCGCGACCATCGTGGCCTCCCGGTTCTCCAGGGACCCGTCCATTGTGGCCGCGCTGCTCCGCTTGCAGTTCCACGATTGCTTCGTCAAT
GTATGTAAATCTTTGCATAAC
TCGATCCTCTACTTCCGGAGCACGTACTTCCGATGTACTCTAAAGCCGTCGTGATGACCGAGCGATGCTAATGTTGCGTCCTTTTTTCCCCTTGAAGGGCTGTGACGCGTCGATCCTGCT
AGACGGGAGCTCGAGCGAGAAAACGGCGGGGCCGAATTTGAGCGTGAGGGGATACGATCTTATCGACGCAGCCAAGGCTGCGGTCGAGGCCATCTGCCCCGGAGTCGTTTCTTGCGCCGA
CATCATCGTCATGGCAACTCGGGACGCTGTCGCTTTG
GTAATGGAAAGAAAAATTACTTCAAACCCCATCGTACCCGATTCGAATTCGGTCGTGTCATGTTCGGATTAGCCCTAATGTTA
TCTCGAAAATTCATTTTCGTTCAATTACAGGCCAAAGGAGGAAGGTACAGCGTGCAAACGGGAAGGCTCGATGGCAAGATATCGCTGGCCCAAAATGTGAATCTCCCAGGTCCTTCCATG
ACAGTTTCTCAGGCTGCTTCGGCCTTTGCTCGAAAGGGATTCACCGTCTCCGACATGGTCATTCTTCTAG
GTACCGACGGTGTATGCTATAATTATACTAATCGCTTTTGGTAGACGGCT
TCGGACTTAATTTATATACACATCATTCGGACTTCGTCAGGTGGCCACACTGTCGGGATTACGCACTGCTCCCTCTTCCAAGACCGGCTCTACAACTTCAACGGATTGGGGAAGCCCGAC
CCGACCATGGATCCTAAGCTCGTGGCTGCCCTCCGGCCAAGGTGCCCGCAGACTGCGACCATCGATAACACCGTGAACCTGGACCAGAATTCTTCGAGCGCGCTCGTCGTCGACAATTCC
TTCTACAAGCAAATAGTTGCCCGGAGAGGGATTCTGCAGATCGACCAAGAGCTAGCGCTCGATAGGCTGAGCAAGTCCCTGGTGGCGACGCTGGCCAATGCCACCAACTTCTCCGCTCGG
TTCGGCCTCGCCATGGTCAAGCTGGGTGCTCTCCAGAGCCGCTTGCCCGGCGAAATTAGGAGTTCTTGCCGAGCCATAAACAAAAGGAGT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGACGGGAAGTAGATTGGCGTTGGCCCTCGCTCTCGTCCTCTCGACCATCGCGCCCCCATGCTCCGCCGCTCTCCGGGCAGGGTTCTACAAAGGCAAGTGTGGCCTCGTGGATGTC
GAGTCCGTGGTCGCGACCATCGTGGCCTCCCGGTTCTCCAGGGACCCGTCCATTGTGGCCGCGCTGCTCCGCTTGCAGTTCCACGATTGCTTCGTCAAT
GGCTGTGACGCGTCGATCCTG
CTAGACGGGAGCTCGAGCGAGAAAACGGCGGGGCCGAATTTGAGCGTGAGGGGATACGATCTTATCGACGCAGCCAAGGCTGCGGTCGAGGCCATCTGCCCCGGAGTCGTTTCTTGCGCC
GACATCATCGTCATGGCAACTCGGGACGCTGTCGCTTTG
GCCAAAGGAGGAAGGTACAGCGTGCAAACGGGAAGGCTCGATGGCAAGATATCGCTGGCCCAAAATGTGAATCTCCCAGGT
CCTTCCATGACAGTTTCTCAGGCTGCTTCGGCCTTTGCTCGAAAGGGATTCACCGTCTCCGACATGGTCATTCTTCTAG
GTGGCCACACTGTCGGGATTACGCACTGCTCCCTCTTCCAA
GACCGGCTCTACAACTTCAACGGATTGGGGAAGCCCGACCCGACCATGGATCCTAAGCTCGTGGCTGCCCTCCGGCCAAGGTGCCCGCAGACTGCGACCATCGATAACACCGTGAACCTG
GACCAGAATTCTTCGAGCGCGCTCGTCGTCGACAATTCCTTCTACAAGCAAATAGTTGCCCGGAGAGGGATTCTGCAGATCGACCAAGAGCTAGCGCTCGATAGGCTGAGCAAGTCCCTG
GTGGCGACGCTGGCCAATGCCACCAACTTCTCCGCTCGGTTCGGCCTCGCCATGGTCAAGCTGGGTGCTCTCCAGAGCCGCTTGCCCGGCGAAATTAGGAGTTCTTGCCGAGCCATAAAC
AAAAGGAGT

Retrieve as FASTA